Transcript: Human NM_001354871.2

Homo sapiens chromosome 2 open reading frame 27A (C2orf27A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
C2orf27A (29798)
Length:
2412
CDS:
1599..2210

Additional Resources:

NCBI RefSeq record:
NM_001354871.2
NBCI Gene record:
C2orf27A (29798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184535 GCACCTGCCCAAGGATTTATT pLKO.1 2325 3UTR 100% 15.000 7.500 Y C2orf27B n/a
2 TRCN0000282653 GGTGCAGAAATACAGCGATTT pLKO_005 1638 CDS 100% 10.800 5.400 Y C2orf27A n/a
3 TRCN0000148648 CCTGCCCAAGGATTTATTCAT pLKO.1 2328 3UTR 100% 5.625 2.813 Y C2orf27B n/a
4 TRCN0000263530 GAGGTGCTGGAGAGCAAGAAA pLKO_005 2080 CDS 100% 5.625 2.813 Y C2orf27A n/a
5 TRCN0000263529 AGAGGGACTTCTCTCATTCAG pLKO_005 1992 CDS 100% 4.950 2.475 Y C2orf27A n/a
6 TRCN0000263528 TGAGGAGCTGCCTGACTTCAT pLKO_005 1784 CDS 100% 4.950 2.475 Y C2orf27A n/a
7 TRCN0000183737 CCCAAGGATTTATTCATAGCT pLKO.1 2332 3UTR 100% 3.000 1.500 Y C2orf27B n/a
8 TRCN0000180039 CAGGTGCAGAAATACAGCGAT pLKO.1 1636 CDS 100% 2.640 1.320 Y C2orf27A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03093 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03093 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_05660 pDONR223 100% 95.3% 93.7% None (many diffs) n/a
4 ccsbBroad304_05660 pLX_304 0% 95.3% 93.7% V5 (many diffs) n/a
5 TRCN0000467721 AGCGGGGGCTGCTCACCACCGACC pLX_317 60.1% 95.3% 93.7% V5 (many diffs) n/a
Download CSV