Transcript: Mouse NM_001355400.1

Mus musculus zinc finger, CCHC domain containing 17 (Zcchc17), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Zcchc17 (619605)
Length:
1937
CDS:
68..673

Additional Resources:

NCBI RefSeq record:
NM_001355400.1
NBCI Gene record:
Zcchc17 (619605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001355400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255313 ATCCCAACAACGTTGTCATTG pLKO_005 243 CDS 100% 10.800 15.120 N Zcchc17 n/a
2 TRCN0000255311 GTCGTCCTGTCGAGTGGATAA pLKO_005 94 CDS 100% 10.800 15.120 N Zcchc17 n/a
3 TRCN0000176457 CGACTTACAGACTTAACACAT pLKO.1 1269 3UTR 100% 4.950 3.960 N Zcchc17 n/a
4 TRCN0000197998 CGTTGTCATTGAGCAAGAAGA pLKO.1 253 CDS 100% 4.950 3.960 N Zcchc17 n/a
5 TRCN0000198221 CCATTTCAAGCCTCTGCTTAA pLKO.1 1174 3UTR 100% 10.800 7.560 N Zcchc17 n/a
6 TRCN0000255312 GCCAGGTGGAACCAAGTATTC pLKO_005 394 CDS 100% 10.800 7.560 N Zcchc17 n/a
7 TRCN0000267567 TGCGCTCAGTGTCTTCATTTC pLKO_005 881 3UTR 100% 10.800 7.560 N Zcchc17 n/a
8 TRCN0000200192 CCACTTTGCCAAGGACTGTTT pLKO.1 367 CDS 100% 4.950 3.465 N Zcchc17 n/a
9 TRCN0000200089 CGATCCCAACAACGTTGTCAT pLKO.1 241 CDS 100% 4.950 3.465 N Zcchc17 n/a
10 TRCN0000197614 CCTTCTGAGATAGTAGATGTT pLKO.1 116 CDS 100% 4.950 2.970 N Zcchc17 n/a
11 TRCN0000177253 GAAGAAGAAGAAGCACAAGAA pLKO.1 637 CDS 100% 4.950 2.475 Y Zcchc17 n/a
12 TRCN0000062684 AGATAGTAGATGTTGGAGATA pLKO.1 123 CDS 100% 4.950 3.465 N ZCCHC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03330 pDONR223 100% 74.6% 78% None (many diffs) n/a
2 ccsbBroad304_03330 pLX_304 0% 74.6% 78% V5 (many diffs) n/a
3 TRCN0000480571 ACTCGGCCCGCCGTGAGCTCTGCT pLX_317 62.8% 74.6% 78% V5 (many diffs) n/a
Download CSV