Transcript: Mouse NM_001362638.1

Mus musculus ATPase, H+ transporting, lysosomal V0 subunit A1 (Atp6v0a1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Atp6v0a1 (11975)
Length:
4235
CDS:
394..2910

Additional Resources:

NCBI RefSeq record:
NM_001362638.1
NBCI Gene record:
Atp6v0a1 (11975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001362638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339646 AGGTCCAATTTCGGGATTTAA pLKO_005 494 CDS 100% 15.000 21.000 N Atp6v0a1 n/a
2 TRCN0000339647 CCAGACACCGCCGACATATAA pLKO_005 1467 CDS 100% 15.000 21.000 N Atp6v0a1 n/a
3 TRCN0000382051 GAGTACTGCTTGGGTTGTATC pLKO_005 2572 CDS 100% 10.800 15.120 N Atp6v0a1 n/a
4 TRCN0000101519 GAGGCCAATTTCGAGAAGATT pLKO.1 685 CDS 100% 5.625 7.875 N Atp6v0a1 n/a
5 TRCN0000101516 CCGGTACATTATTCTTCTGAT pLKO.1 1731 CDS 100% 4.950 6.930 N Atp6v0a1 n/a
6 TRCN0000339729 TCGGCACTTACCGAGAGATTA pLKO_005 1541 CDS 100% 13.200 10.560 N Atp6v0a1 n/a
7 TRCN0000101515 CCTGTGGAAGTGACACTAAAT pLKO.1 3967 3UTR 100% 13.200 9.240 N Atp6v0a1 n/a
8 TRCN0000288502 CCTGTGGAAGTGACACTAAAT pLKO_005 3967 3UTR 100% 13.200 9.240 N Atp6v0a1 n/a
9 TRCN0000101518 CAGAACATAGTAGATGCTTAT pLKO.1 1516 CDS 100% 10.800 7.560 N Atp6v0a1 n/a
10 TRCN0000288573 CAGAACATAGTAGATGCTTAT pLKO_005 1516 CDS 100% 10.800 7.560 N Atp6v0a1 n/a
11 TRCN0000380580 CCTACCCAGAGTCTGGTAATG pLKO_005 2252 CDS 100% 10.800 7.560 N Atp6v0a1 n/a
12 TRCN0000101517 GCTTCTGTTTAAGCCGCTGAT pLKO.1 2346 CDS 100% 4.050 2.835 N Atp6v0a1 n/a
13 TRCN0000038638 CAACTCCTTCAAGATGAAGAT pLKO.1 1992 CDS 100% 4.950 2.475 Y TCIRG1 n/a
14 TRCN0000289223 CAACTCCTTCAAGATGAAGAT pLKO_005 1992 CDS 100% 4.950 2.475 Y TCIRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00140 pDONR223 100% 88.9% 96% None (many diffs) n/a
2 ccsbBroad304_00140 pLX_304 0% 88.9% 96% V5 (many diffs) n/a
3 TRCN0000468785 CAAACTTCCGTCTGTAGTTACGTC pLX_317 2.2% 88.9% 96% V5 (many diffs) n/a
Download CSV