Transcript: Human NM_001362971.1

Homo sapiens PHD finger protein 20 like 1 (PHF20L1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
PHF20L1 (51105)
Length:
6181
CDS:
322..3297

Additional Resources:

NCBI RefSeq record:
NM_001362971.1
NBCI Gene record:
PHF20L1 (51105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226145 TTGGACAGACTGTCGCTATTA pLKO_005 609 CDS 100% 13.200 18.480 N Phf20l1 n/a
2 TRCN0000230402 TTGGACAGACTGTCGCTATTA pLKO_005 609 CDS 100% 13.200 18.480 N PHF20L1 n/a
3 TRCN0000135728 CCGTTGATCTTAGTGGTGAAA pLKO.1 2132 CDS 100% 4.950 6.930 N PHF20L1 n/a
4 TRCN0000230404 TACGGAAATTTAGGGTATTTA pLKO_005 3780 3UTR 100% 15.000 12.000 N PHF20L1 n/a
5 TRCN0000135709 GTGGATTTACTGGGATAGCAA pLKO.1 489 CDS 100% 3.000 2.400 N PHF20L1 n/a
6 TRCN0000230403 AGAATGTGCGGGTTATCATTT pLKO_005 2488 CDS 100% 13.200 9.240 N PHF20L1 n/a
7 TRCN0000230401 GAGCGCTGGAGTCATCGTTAT pLKO_005 463 CDS 100% 10.800 7.560 N PHF20L1 n/a
8 TRCN0000137779 GCTCGCAGCAAGAAATGCAAA pLKO.1 1282 CDS 100% 4.950 3.465 N PHF20L1 n/a
9 TRCN0000135152 CTCAGATTCCTCTTACCGTAA pLKO.1 1707 CDS 100% 4.050 2.835 N PHF20L1 n/a
10 TRCN0000138495 CCTCAGATTCCTCTTACCGTA pLKO.1 1706 CDS 100% 2.640 1.848 N PHF20L1 n/a
11 TRCN0000217959 ATTGGATAGCTTTAGTCAAAG pLKO_005 752 CDS 100% 10.800 6.480 N PHF20L1 n/a
12 TRCN0000135276 CCTGCCAAGATTGAAGCAATT pLKO.1 631 CDS 100% 10.800 6.480 N PHF20L1 n/a
13 TRCN0000134493 GCTCAGATGATGATGATGTTA pLKO.1 2885 CDS 100% 5.625 3.375 N PHF20L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11950 pDONR223 100% 32.5% 32.5% None 1_2004del n/a
2 ccsbBroad304_11950 pLX_304 0% 32.5% 32.5% V5 1_2004del n/a
3 TRCN0000465892 TGACTCGGTCACCGGAGAGGATTT pLX_317 38.1% 32.5% 32.5% V5 1_2004del n/a
4 ccsbBroadEn_03206 pDONR223 100% 28.7% 28.6% None 854_863delCGATTTCACC;866_2973del n/a
5 ccsbBroad304_03206 pLX_304 0% 28.7% 28.6% V5 854_863delCGATTTCACC;866_2973del n/a
6 TRCN0000467004 ACATATTCCTGAGATAGCATTCCT pLX_317 27.7% 28.7% 28.6% V5 854_863delCGATTTCACC;866_2973del n/a
Download CSV