Transcript: Human NM_001362980.1

Homo sapiens golgin A7 (GOLGA7), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
GOLGA7 (51125)
Length:
1941
CDS:
101..514

Additional Resources:

NCBI RefSeq record:
NM_001362980.1
NBCI Gene record:
GOLGA7 (51125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134945 GTCATATCTCGAAGGTTGTTT pLKO.1 289 CDS 100% 5.625 7.875 N GOLGA7 n/a
2 TRCN0000343301 GTCATATCTCGAAGGTTGTTT pLKO_005 289 CDS 100% 5.625 7.875 N GOLGA7 n/a
3 TRCN0000134494 GAAGGTTGTTTGGCTTGTTTA pLKO.1 299 CDS 100% 13.200 9.240 N GOLGA7 n/a
4 TRCN0000137030 CGAAGGTTGTTTGGCTTGTTT pLKO.1 298 CDS 100% 5.625 3.938 N GOLGA7 n/a
5 TRCN0000137507 GAGGACTGCGAGTTATTGAAA pLKO.1 453 CDS 100% 5.625 3.938 N GOLGA7 n/a
6 TRCN0000174419 CAGCAGTTTGAAGAAACAGTT pLKO.1 221 CDS 100% 4.950 3.465 N Golga7 n/a
7 TRCN0000319965 CAGCAGTTTGAAGAAACAGTT pLKO_005 221 CDS 100% 4.950 3.465 N Golga7 n/a
8 TRCN0000136831 CCATCTTCCTATGCATGGAAA pLKO.1 330 CDS 100% 4.950 3.465 N GOLGA7 n/a
9 TRCN0000136894 CCTTTATGCAGAAGCAGAGAA pLKO.1 256 CDS 100% 4.950 3.465 N GOLGA7 n/a
10 TRCN0000352669 CCTTTATGCAGAAGCAGAGAA pLKO_005 256 CDS 100% 4.950 3.465 N GOLGA7 n/a
11 TRCN0000174593 GAAGAAACAGTTCGAACTCTA pLKO.1 230 CDS 100% 4.950 3.465 N Golga7 n/a
12 TRCN0000320041 GAAGAAACAGTTCGAACTCTA pLKO_005 230 CDS 100% 4.950 3.465 N Golga7 n/a
13 TRCN0000137226 GAGAAGATCTATGCTCCACAA pLKO.1 404 CDS 100% 4.050 2.835 N GOLGA7 n/a
14 TRCN0000134207 CATTTATGAAGACAGAGGCAT pLKO.1 478 CDS 100% 2.640 1.848 N GOLGA7 n/a
15 TRCN0000134349 GTTTGGCTTGTTTAACAGCAT pLKO.1 306 CDS 100% 2.640 1.848 N GOLGA7 n/a
16 TRCN0000343349 GTTTGGCTTGTTTAACAGCAT pLKO_005 306 CDS 100% 2.640 1.848 N GOLGA7 n/a
17 TRCN0000134022 CAGCATATACCATCTTCCTAT pLKO.1 321 CDS 100% 4.950 2.970 N GOLGA7 n/a
18 TRCN0000134748 GAGCAGAATGAGAAGATCTAT pLKO.1 395 CDS 100% 5.625 2.813 Y GOLGA7 n/a
19 TRCN0000343302 GAGCAGAATGAGAAGATCTAT pLKO_005 395 CDS 100% 5.625 2.813 Y GOLGA7 n/a
20 TRCN0000174453 CTTTATGCAGAAGCAGAGAAA pLKO.1 257 CDS 100% 4.950 3.465 N Golga7 n/a
21 TRCN0000319967 CTTTATGCAGAAGCAGAGAAA pLKO_005 257 CDS 100% 4.950 3.465 N Golga7 n/a
22 TRCN0000144947 GAGCAGAATGAGAAGATCTTT pLKO.1 395 CDS 100% 5.625 2.813 Y GOLGA7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08225 pDONR223 100% 99.5% 99.2% None 7C>G;180C>T n/a
2 ccsbBroad304_08225 pLX_304 0% 99.5% 99.2% V5 7C>G;180C>T n/a
3 TRCN0000468400 CTGCCTGTCACAGATCGGCATATT pLX_317 74.4% 99.5% 99.2% V5 7C>G;180C>T n/a
4 ccsbBroadEn_03221 pDONR223 100% 95.4% 89% None 366_367insTTTAG;398_411del n/a
5 ccsbBroad304_03221 pLX_304 0% 95.4% 89% V5 366_367insTTTAG;398_411del n/a
6 TRCN0000470005 GATGCGGTGTGACGGATGTTCCCA pLX_317 67.2% 95.4% 89% V5 366_367insTTTAG;398_411del n/a
Download CSV