Transcript: Human NM_001363311.1

Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein (PHYHIP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
PHYHIP (9796)
Length:
2266
CDS:
709..1701

Additional Resources:

NCBI RefSeq record:
NM_001363311.1
NBCI Gene record:
PHYHIP (9796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250494 CCAGCACCAACCTCTACTTTG pLKO_005 1355 CDS 100% 10.800 7.560 N Phyhip n/a
2 TRCN0000167078 CCATTACTTCATTGACCTTAA pLKO.1 813 CDS 100% 10.800 7.560 N PHYHIP n/a
3 TRCN0000426405 ACCTCTACTTTGCGGACTTCT pLKO_005 1364 CDS 100% 4.950 3.465 N PHYHIP n/a
4 TRCN0000414163 AGCCTTACCTGAAGGACAACA pLKO_005 1190 CDS 100% 4.950 3.465 N PHYHIP n/a
5 TRCN0000168819 CAACCATCACAAGGAGTACTT pLKO.1 1134 CDS 100% 4.950 3.465 N PHYHIP n/a
6 TRCN0000173019 CCTGGACATTGCTTGCAACAA pLKO.1 1476 CDS 100% 4.950 3.465 N PHYHIP n/a
7 TRCN0000444723 TCAGCTGCAACACGGAGTTCA pLKO_005 1259 CDS 100% 4.950 3.465 N PHYHIP n/a
8 TRCN0000167097 CATTGACCTTAACAAGAAGGA pLKO.1 822 CDS 100% 2.640 1.848 N PHYHIP n/a
9 TRCN0000172426 CCTGGAGATCATCTACACTGA pLKO.1 1557 CDS 100% 2.640 1.848 N PHYHIP n/a
10 TRCN0000250493 TGGAGAGGGTCACCCATTATT pLKO_005 800 CDS 100% 15.000 10.500 N Phyhip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07488 pDONR223 100% 99.4% 98.7% None (many diffs) n/a
2 ccsbBroad304_07488 pLX_304 0% 99.4% 98.7% V5 (many diffs) n/a
3 TRCN0000469780 GCCTTCAGACTATTATAACTATCC pLX_317 32.2% 99.4% 98.7% V5 (many diffs) n/a
Download CSV