Transcript: Human NM_001363524.2

Homo sapiens leucine rich repeat and fibronectin type III domain containing 4 (LRFN4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
LRFN4 (78999)
Length:
2431
CDS:
244..2151

Additional Resources:

NCBI RefSeq record:
NM_001363524.2
NBCI Gene record:
LRFN4 (78999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434161 AGCCTTCGACGACTTCCTAGA pLKO_005 657 CDS 100% 4.050 5.670 N LRFN4 n/a
2 TRCN0000426705 CCAACGGGACCTTAGAGATTG pLKO_005 1238 CDS 100% 10.800 7.560 N LRFN4 n/a
3 TRCN0000222086 CCCAGTGTGGATGTTCCAAAT pLKO.1 1533 CDS 100% 10.800 7.560 N LRFN4 n/a
4 TRCN0000418213 AGACCCTCATCTACCGGATTG pLKO_005 1577 CDS 100% 6.000 4.200 N Lrfn4 n/a
5 TRCN0000415086 CAATCTGCAGCACCTCATCCT pLKO_005 603 CDS 100% 2.640 1.848 N LRFN4 n/a
6 TRCN0000062880 CCATAACCTTATTGACGCACT pLKO.1 774 CDS 100% 2.160 1.512 N LRFN4 n/a
7 TRCN0000417177 ACGTCCAGTCCCAGACCAATG pLKO_005 1907 CDS 100% 2.000 1.400 N LRFN4 n/a
8 TRCN0000222087 CGAAGATGAGACCCTCATCTA pLKO.1 1569 CDS 100% 0.495 0.347 N LRFN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04017 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04017 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470428 GCGTGCTTCATTTGTAATAATTTT pLX_317 20.9% 100% 100% V5 n/a
4 ccsbBroadEn_12528 pDONR223 100% 51% 51% None 1_933del n/a
5 ccsbBroad304_12528 pLX_304 0% 51% 51% V5 1_933del n/a
6 TRCN0000471108 ACGACTATAATCCCTGAATCGCAC pLX_317 46.3% 51% 51% V5 1_933del n/a
Download CSV