Transcript: Human NM_001363656.2

Homo sapiens protein phosphatase 2 scaffold subunit Aalpha (PPP2R1A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PPP2R1A (5518)
Length:
5728
CDS:
959..2191

Additional Resources:

NCBI RefSeq record:
NM_001363656.2
NBCI Gene record:
PPP2R1A (5518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231599 ACCAGGATGTGGACGTCAAAT pLKO_005 2130 CDS 100% 13.200 18.480 N PPP2R1A n/a
2 TRCN0000231509 TTGCCAATGTCCGCTTCAATG pLKO_005 2019 CDS 100% 10.800 8.640 N PPP2R1A n/a
3 TRCN0000002566 GCCTTTCCTTACAGATACCAT pLKO.1 577 5UTR 100% 3.000 2.400 N PPP2R1A n/a
4 TRCN0000231600 ACTGGATCCTGCTGCTGTAAT pLKO_005 2472 3UTR 100% 13.200 9.240 N PPP2R1A n/a
5 TRCN0000231507 CTGGCTTGTGGATCATGTATA pLKO_005 1768 CDS 100% 13.200 9.240 N PPP2R1A n/a
6 TRCN0000380176 GTTCTTTGATGAGAAACTTAA pLKO_005 1732 CDS 100% 13.200 9.240 N PPP2R1A n/a
7 TRCN0000381088 ACTGTGTGAACGAGGTGATTG pLKO_005 1587 CDS 100% 10.800 7.560 N PPP2R1A n/a
8 TRCN0000231508 CTACGCTCTTCTGCATCAATG pLKO_005 1920 CDS 100% 10.800 7.560 N PPP2R1A n/a
9 TRCN0000010716 CCTGGCTTGTGGATCATGTAT pLKO.1 1767 CDS 100% 5.625 3.938 N PPP2R1A n/a
10 TRCN0000010718 GACTGTGTGAACGAGGTGATT pLKO.1 1586 CDS 100% 4.950 3.465 N PPP2R1A n/a
11 TRCN0000010717 ATTTACTTCTCCACCTCCCGT pLKO.1 2508 3UTR 100% 0.660 0.462 N PPP2R1A n/a
12 TRCN0000380757 CCTTCCAGAACCTGATGAAAG pLKO_005 1278 CDS 100% 10.800 6.480 N PPP2R1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363656.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01263 pDONR223 100% 69.6% 69.6% None 0_1ins537 n/a
2 ccsbBroad304_01263 pLX_304 0% 69.6% 69.6% V5 0_1ins537 n/a
3 TRCN0000471418 CGAGTTAATCTGGCAATCTATCTT pLX_317 27.3% 69.6% 69.6% V5 0_1ins537 n/a
Download CSV