Transcript: Human NM_001363686.2

Homo sapiens HBS1 like translational GTPase (HBS1L), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HBS1L (10767)
Length:
7233
CDS:
770..2332

Additional Resources:

NCBI RefSeq record:
NM_001363686.2
NBCI Gene record:
HBS1L (10767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146608 CCAATAGCTCTTGAGCTATAT pLKO.1 2225 CDS 100% 1.320 1.848 N HBS1L n/a
2 TRCN0000353598 TTTGCCTTTGAAACGTTAATA pLKO_005 2551 3UTR 100% 15.000 10.500 N HBS1L n/a
3 TRCN0000148280 CCCATGAGTATGCAAATCAAT pLKO.1 5102 3UTR 100% 5.625 3.938 N HBS1L n/a
4 TRCN0000147687 GCAGTTCTGAAGAACAAGTTT pLKO.1 441 5UTR 100% 5.625 3.938 N HBS1L n/a
5 TRCN0000330222 GCAGTTCTGAAGAACAAGTTT pLKO_005 441 5UTR 100% 5.625 3.938 N HBS1L n/a
6 TRCN0000146967 CGTCTTTATTCATGCCTTGAT pLKO.1 369 5UTR 100% 4.950 3.465 N HBS1L n/a
7 TRCN0000353653 CGTCTTTATTCATGCCTTGAT pLKO_005 369 5UTR 100% 4.950 3.465 N HBS1L n/a
8 TRCN0000147604 GCGATCTATTGACAAACCTTT pLKO.1 1720 CDS 100% 4.950 3.465 N HBS1L n/a
9 TRCN0000353597 GCGATCTATTGACAAACCTTT pLKO_005 1720 CDS 100% 4.950 3.465 N HBS1L n/a
10 TRCN0000147623 GCCCTTTCTTTATCTTGCTTA pLKO.1 3199 3UTR 100% 4.950 2.970 N HBS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02521 pDONR223 100% 76% 76% None 0_1ins492 n/a
2 ccsbBroad304_02521 pLX_304 0% 76% 76% V5 0_1ins492 n/a
3 TRCN0000476887 CTCATTAGAGTGAGAAGAGATGTA pLX_317 17.9% 76% 76% V5 0_1ins492 n/a
Download CSV