Transcript: Human NM_001363756.1

Homo sapiens Ecm29 proteasome adaptor and scaffold (ECPAS), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-23
Taxon:
Homo sapiens (human)
Gene:
ECPAS (23392)
Length:
7107
CDS:
247..5766

Additional Resources:

NCBI RefSeq record:
NM_001363756.1
NBCI Gene record:
ECPAS (23392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263356 GGGCGCTACATACGGACTTTA pLKO_005 2107 CDS 100% 13.200 18.480 N ECPAS n/a
2 TRCN0000263353 TGCAATTTGTGCATCATATTT pLKO_005 1355 CDS 100% 15.000 10.500 N ECPAS n/a
3 TRCN0000263355 GCCTTATGGTTACGTGTTAAA pLKO_005 777 CDS 100% 13.200 9.240 N ECPAS n/a
4 TRCN0000263354 TGCCGTGGTTTAGACCATTTA pLKO_005 6617 3UTR 100% 13.200 9.240 N ECPAS n/a
5 TRCN0000175988 GAAACAAACAAGTGCCATGTT pLKO.1 5780 3UTR 100% 4.950 3.465 N AI314180 n/a
6 TRCN0000345641 GAAACAAACAAGTGCCATGTT pLKO_005 5780 3UTR 100% 4.950 3.465 N AI314180 n/a
7 TRCN0000176175 GAAGAAACAAACAAGTGCCAT pLKO.1 5777 3UTR 100% 2.640 1.584 N AI314180 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14082 pDONR223 100% 28.2% 27.8% None 1_3960del;5497_5498insN n/a
2 ccsbBroad304_14082 pLX_304 0% 28.2% 27.8% V5 (not translated due to prior stop codon) 1_3960del;5497_5498insN n/a
3 TRCN0000470659 CGTTAAGTTTAGGACCCAGTAGAC pLX_317 29.1% 28.2% 27.9% V5 (not translated due to frame shift) 1_3960del;5496_5497insAA n/a
Download CSV