Transcript: Human NM_001363837.1

Homo sapiens phosphorylase kinase regulatory subunit beta (PHKB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PHKB (5257)
Length:
5491
CDS:
53..3334

Additional Resources:

NCBI RefSeq record:
NM_001363837.1
NBCI Gene record:
PHKB (5257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197195 GCATGTCATAGCCAATCTAAC pLKO.1 3483 3UTR 100% 10.800 15.120 N PHKB n/a
2 TRCN0000006196 CGCTGCATGTTGTATGATCAA pLKO.1 3613 3UTR 100% 4.950 6.930 N PHKB n/a
3 TRCN0000196396 GCAGCCATTAATATACGAACT pLKO.1 3410 3UTR 100% 4.050 5.670 N PHKB n/a
4 TRCN0000006199 CCTGTCAGATATGACCATGTA pLKO.1 2956 CDS 100% 4.950 3.960 N PHKB n/a
5 TRCN0000194723 CAGCTGAAATTAAGCTATTTG pLKO.1 1107 CDS 100% 13.200 9.240 N PHKB n/a
6 TRCN0000195235 CTCATGATTATGCCAACTATA pLKO.1 3542 3UTR 100% 13.200 9.240 N PHKB n/a
7 TRCN0000196687 GACTGGTCAAAGAAGCATTTA pLKO.1 3129 CDS 100% 13.200 9.240 N PHKB n/a
8 TRCN0000196867 GAACTTCTCTTAGTGGTATTG pLKO.1 3750 3UTR 100% 10.800 7.560 N PHKB n/a
9 TRCN0000195461 GCTTAATCAAGGCAGCCATTA pLKO.1 3399 3UTR 100% 10.800 7.560 N PHKB n/a
10 TRCN0000006198 CCAGAGAATCAAGATCACATA pLKO.1 903 CDS 100% 4.950 3.465 N PHKB n/a
11 TRCN0000006197 GCTCAGTTTATGAACCTCTTA pLKO.1 129 CDS 100% 4.950 3.465 N PHKB n/a
12 TRCN0000006200 CCCAACTTCATCACAAAGGAA pLKO.1 2309 CDS 100% 3.000 2.100 N PHKB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14754 pDONR223 0% 98.1% 98.2% None (many diffs) n/a
2 ccsbBroad304_14754 pLX_304 0% 98.1% 98.2% V5 (many diffs) n/a
3 TRCN0000474290 CTTATGACAAAAGCCCCCCGACTC pLX_317 13.7% 98.1% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_14753 pDONR223 74.1% 98% 97.9% None (many diffs) n/a
5 ccsbBroad304_14753 pLX_304 0% 98% 97.9% V5 (many diffs) n/a
6 TRCN0000478777 TGTCCCTAGTTAATCGCTATTCCA pLX_317 9.7% 98% 97.9% V5 (many diffs) n/a
Download CSV