Transcript: Human NM_001364147.2

Homo sapiens casein kinase 1 gamma 3 (CSNK1G3), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CSNK1G3 (1456)
Length:
4030
CDS:
445..1377

Additional Resources:

NCBI RefSeq record:
NM_001364147.2
NBCI Gene record:
CSNK1G3 (1456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145821 AGGCTGACACATTAAAGGAG pXPR_003 AGG 435 47% 5 0.4368 CSNK1G3 CSNK1G3 77361
2 BRDN0001144972 AACTTCTTAATAGGACGACC pXPR_003 AGG 176 19% 3 -0.0627 CSNK1G3 CSNK1G3 77363
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355670 TTTCGGCCCTTGTGGTAAATA pLKO_005 417 5UTR 100% 15.000 21.000 N CSNK1G3 n/a
2 TRCN0000023764 CCAGGTTGTAAGTTCTACAAA pLKO.1 1188 CDS 100% 0.563 0.788 N Csnk1g3 n/a
3 TRCN0000196591 GCAACATATCTTCGTTATGTA pLKO.1 955 CDS 100% 0.563 0.788 N CSNK1G3 n/a
4 TRCN0000338228 CAAAGTAGAAGAGACGATTTA pLKO_005 781 CDS 100% 13.200 10.560 N CSNK1G3 n/a
5 TRCN0000010550 CCCAGCAAGTTATTCACATTA pLKO.1 635 CDS 100% 13.200 10.560 N CSNK1G3 n/a
6 TRCN0000196897 GCTAGATATATGAGCATAAAC pLKO.1 742 CDS 100% 13.200 9.240 N CSNK1G3 n/a
7 TRCN0000196403 GTGATGTATGTTGGAGTTATA pLKO.1 2193 3UTR 100% 13.200 9.240 N CSNK1G3 n/a
8 TRCN0000355669 TTTCCAGAAATGGCAACATAT pLKO_005 943 CDS 100% 13.200 9.240 N CSNK1G3 n/a
9 TRCN0000000808 CACCGAAACTTACTGCTGAAT pLKO.1 2287 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
10 TRCN0000338227 CACCGAAACTTACTGCTGAAT pLKO_005 2287 3UTR 100% 4.950 3.465 N CSNK1G3 n/a
11 TRCN0000195537 CCCTACTGAAGTAGAAGTGAT pLKO.1 1266 CDS 100% 4.950 3.465 N CSNK1G3 n/a
12 TRCN0000000809 CCGGAGACAAAGAAACACATA pLKO.1 688 CDS 100% 4.950 3.465 N CSNK1G3 n/a
13 TRCN0000338167 CCGGAGACAAAGAAACACATA pLKO_005 688 CDS 100% 4.950 3.465 N CSNK1G3 n/a
14 TRCN0000000810 AGGACGTTCAAATGCACCCAT pLKO.1 1239 CDS 100% 2.640 1.848 N CSNK1G3 n/a
15 TRCN0000000811 ACTTCTTAATAGGACGACCAA pLKO.1 605 CDS 100% 2.640 3.696 N CSNK1G3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364147.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06057 pDONR223 100% 73.2% 73.2% None 0_1ins339 n/a
2 ccsbBroad304_06057 pLX_304 0% 73.2% 73.2% V5 0_1ins339 n/a
3 TRCN0000477806 CGATTTGCAATTGATGCTTGGCAT pLX_317 26.7% 73.2% 73.2% V5 0_1ins339 n/a
4 ccsbBroadEn_14603 pDONR223 100% 73% 72.5% None (many diffs) n/a
5 ccsbBroad304_14603 pLX_304 0% 73% 72.5% V5 (many diffs) n/a
6 TRCN0000467288 CGAATTGCCCCTTACTCTATAGGA pLX_317 11.6% 73% 72.5% V5 (many diffs) n/a
7 TRCN0000489732 TAATGTCAATGTAAAACACCATGT pLX_317 37.4% 41.6% 24.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV