Transcript: Human NM_001364903.1

Homo sapiens sorting nexin 7 (SNX7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SNX7 (51375)
Length:
1856
CDS:
324..1487

Additional Resources:

NCBI RefSeq record:
NM_001364903.1
NBCI Gene record:
SNX7 (51375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161560 GCCCAATTCATATTCTGTGGT pLKO.1 997 CDS 100% 2.640 2.112 N SNX7 n/a
2 TRCN0000323283 AGGAATGGTGGAACGCTTTAA pLKO_005 632 CDS 100% 13.200 9.240 N SNX7 n/a
3 TRCN0000323364 ATTGCTGATCATCCAACTTTA pLKO_005 705 CDS 100% 13.200 9.240 N SNX7 n/a
4 TRCN0000162493 CAGAAGAGGATCTGGTTGATA pLKO.1 1024 CDS 100% 5.625 3.938 N SNX7 n/a
5 TRCN0000323290 CAGAAGAGGATCTGGTTGATA pLKO_005 1024 CDS 100% 5.625 3.938 N SNX7 n/a
6 TRCN0000160597 CCAAAGTTATTCTTTCTGGAT pLKO.1 1535 3UTR 100% 2.640 1.848 N SNX7 n/a
7 TRCN0000323289 CCAAAGTTATTCTTTCTGGAT pLKO_005 1535 3UTR 100% 2.640 1.848 N SNX7 n/a
8 TRCN0000162492 CCACTCTGATTATTCCACCAT pLKO.1 589 CDS 100% 2.640 1.848 N SNX7 n/a
9 TRCN0000166387 CGTCCTCAATGAGAGGAGTTA pLKO.1 841 CDS 100% 0.495 0.347 N SNX7 n/a
10 TRCN0000323378 TGAGGAGAATATCCATTATTA pLKO_005 1382 CDS 100% 15.000 9.000 N SNX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11983 pDONR223 100% 99.7% 99.7% None 457T>C;1104G>A;1107A>G n/a
2 ccsbBroad304_11983 pLX_304 0% 99.7% 99.7% V5 457T>C;1104G>A;1107A>G n/a
3 TRCN0000465597 CATACGACGACCCCTCAGTGATGG pLX_317 32.4% 99.7% 99.7% V5 457T>C;1104G>A;1107A>G n/a
4 ccsbBroadEn_10507 pDONR223 100% 86.7% 86.8% None 933_1085del;1104G>A n/a
5 ccsbBroad304_10507 pLX_304 0% 86.7% 86.8% V5 933_1085del;1104G>A n/a
6 TRCN0000466413 TGATTAATGCACCGATCGCGCCCA pLX_317 35.5% 86.7% 86.8% V5 933_1085del;1104G>A n/a
Download CSV