Transcript: Human NM_001365069.1

Homo sapiens astrotactin 2 (ASTN2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
ASTN2 (23245)
Length:
6866
CDS:
120..4127

Additional Resources:

NCBI RefSeq record:
NM_001365069.1
NBCI Gene record:
ASTN2 (23245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129549 GCACCACTACAACTCTCACTA pLKO.1 3818 CDS 100% 4.950 6.930 N ASTN2 n/a
2 TRCN0000129308 CAAACGGTTTCTCCTGTGGAT pLKO.1 4266 3UTR 100% 2.640 3.696 N ASTN2 n/a
3 TRCN0000129307 CGCAACTTCAAGTGTGTGTCT pLKO.1 2097 CDS 100% 2.640 3.696 N ASTN2 n/a
4 TRCN0000129797 CCAAATTCAATGATACCCTCT pLKO.1 2407 CDS 100% 2.160 3.024 N ASTN2 n/a
5 TRCN0000129639 CAGTATCTACTCAGTCATCTT pLKO.1 3554 CDS 100% 4.950 3.960 N ASTN2 n/a
6 TRCN0000426953 GTGAGGAAGCATGGGTCTTTA pLKO_005 4604 3UTR 100% 13.200 9.240 N ASTN2 n/a
7 TRCN0000442282 GTTGCGTGGAGGAGTACAAAC pLKO_005 2314 CDS 100% 10.800 7.560 N ASTN2 n/a
8 TRCN0000128773 CAAACCCACAATTCCGTCATT pLKO.1 939 CDS 100% 4.950 3.465 N ASTN2 n/a
9 TRCN0000131092 GAGCTGAAACCCATGAAGGAT pLKO.1 2157 CDS 100% 3.000 2.100 N ASTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07862 pDONR223 100% 32.1% 30.4% None (many diffs) n/a
2 ccsbBroad304_07862 pLX_304 0% 32.1% 30.4% V5 (many diffs) n/a
3 TRCN0000467833 TAGGACATTCCAATACTGCTACGC pLX_317 35.2% 32.1% 30.4% V5 (many diffs) n/a
4 ccsbBroadEn_15754 pDONR223 0% 28.8% 28.7% None (many diffs) n/a
5 ccsbBroad304_15754 pLX_304 0% 28.8% 28.7% V5 (many diffs) n/a
6 TRCN0000473836 ATTGTGCGAGGCATCCGAGAACGT pLX_317 37.5% 28.8% 28.7% V5 (many diffs) n/a
7 ccsbBroadEn_15753 pDONR223 0% 13.9% 12.9% None (many diffs) n/a
8 ccsbBroad304_15753 pLX_304 0% 13.9% 12.9% V5 (many diffs) n/a
9 TRCN0000474437 CTCTTTTGGGTTCCCTAAAGGGCG pLX_317 64.9% 13.9% 12.9% V5 (many diffs) n/a
Download CSV