Transcript: Human NM_001365674.2

Homo sapiens cordon-bleu WH2 repeat protein like 1 (COBLL1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
COBLL1 (22837)
Length:
9348
CDS:
165..3590

Additional Resources:

NCBI RefSeq record:
NM_001365674.2
NBCI Gene record:
COBLL1 (22837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426815 GATCCGTTGCATACACTATTG pLKO_005 711 CDS 100% 10.800 15.120 N COBLL1 n/a
2 TRCN0000140035 GAAGAGAGTATCGGGTCACTA pLKO.1 2819 CDS 100% 4.950 6.930 N COBLL1 n/a
3 TRCN0000414625 ACCATTTCCAAACCATATATT pLKO_005 1026 CDS 100% 15.000 10.500 N COBLL1 n/a
4 TRCN0000416933 GAGTCAAGGCACCCTAATTAT pLKO_005 2177 CDS 100% 15.000 10.500 N COBLL1 n/a
5 TRCN0000427138 GTGTAGCAATTGGAAATATTT pLKO_005 4000 3UTR 100% 15.000 10.500 N COBLL1 n/a
6 TRCN0000122132 GCCTTGAAGAGATAGATGAAA pLKO.1 1450 CDS 100% 5.625 3.938 N COBLL1 n/a
7 TRCN0000145500 GCACATGGTAATGATGATCTT pLKO.1 2238 CDS 100% 4.950 3.465 N COBLL1 n/a
8 TRCN0000122795 GAAGGTCAAGACTCAGCCATT pLKO.1 3538 CDS 100% 4.050 2.835 N COBLL1 n/a
9 TRCN0000432295 ATATGCTGCTTTAGAACTTTA pLKO_005 3803 3UTR 100% 13.200 7.920 N COBLL1 n/a
10 TRCN0000139847 CAAACTCTCCTGAGGAGCTAT pLKO.1 1399 CDS 100% 4.950 2.970 N COBLL1 n/a
11 TRCN0000140904 CCATCAAACTCTGAGGCACAT pLKO.1 1887 CDS 100% 4.050 2.430 N COBLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11632 pDONR223 100% 7.9% 6.9% None (many diffs) n/a
2 ccsbBroad304_11632 pLX_304 0% 7.9% 6.9% V5 (many diffs) n/a
3 TRCN0000479824 AGACATCCGGGACGTTCCACGCTC pLX_317 100% 7.9% 6.9% V5 (many diffs) n/a
Download CSV