Transcript: Human NM_001365828.1

Homo sapiens synaptotagmin like 2 (SYTL2), transcript variant o, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SYTL2 (54843)
Length:
2469
CDS:
365..1495

Additional Resources:

NCBI RefSeq record:
NM_001365828.1
NBCI Gene record:
SYTL2 (54843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234465 TAACGAAATACTGCGGTATAA pLKO_005 778 CDS 100% 13.200 18.480 N SYTL2 n/a
2 TRCN0000382116 CCTATTTGCTACCAGACAAAG pLKO_005 702 CDS 100% 10.800 15.120 N SYTL2 n/a
3 TRCN0000059948 CGGTGGAATCTGATCTTGAAA pLKO.1 1536 3UTR 100% 5.625 7.875 N SYTL2 n/a
4 TRCN0000059949 CGGGATACATTTAAGCGCAAT pLKO.1 851 CDS 100% 4.050 5.670 N SYTL2 n/a
5 TRCN0000234468 GTCGCAGAAAGATACTCAAAG pLKO_005 1909 3UTR 100% 10.800 8.640 N SYTL2 n/a
6 TRCN0000380004 TGGACCTTAAGAAACTATTTA pLKO_005 1976 3UTR 100% 15.000 10.500 N SYTL2 n/a
7 TRCN0000234466 ATTTGGCATCGGGATACATTT pLKO_005 842 CDS 100% 13.200 9.240 N SYTL2 n/a
8 TRCN0000234464 CTTAGCAGCAGCGGATGTAAA pLKO_005 652 CDS 100% 13.200 9.240 N SYTL2 n/a
9 TRCN0000379632 TGGAAGTTAAAGGAAATATTC pLKO_005 567 CDS 100% 13.200 9.240 N SYTL2 n/a
10 TRCN0000382033 TGGCAGTGTGATGAGTGTTTA pLKO_005 526 CDS 100% 13.200 9.240 N SYTL2 n/a
11 TRCN0000379597 GAGCTCTTTAACCAATCTTAG pLKO_005 469 CDS 100% 10.800 7.560 N SYTL2 n/a
12 TRCN0000234467 TCAACCACACTATGGTGTATG pLKO_005 1218 CDS 100% 10.800 7.560 N SYTL2 n/a
13 TRCN0000059952 CCCTATCTTCAACCACACTAT pLKO.1 1210 CDS 100% 4.950 3.465 N SYTL2 n/a
14 TRCN0000059950 GCCTATTTGCTACCAGACAAA pLKO.1 701 CDS 100% 4.950 3.465 N SYTL2 n/a
15 TRCN0000059951 GCCTTGATCTACCACTGCTAA pLKO.1 1092 CDS 100% 4.950 3.465 N SYTL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08416 pDONR223 100% 99.9% 99.7% None 6C>A n/a
2 ccsbBroad304_08416 pLX_304 0% 99.9% 99.7% V5 6C>A n/a
3 TRCN0000467832 ATCTGAGAGGATTAGAATCCCTTC pLX_317 34.8% 99.9% 99.7% V5 6C>A n/a
Download CSV