Transcript: Human NM_001365905.1

Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 1 (MAGI1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MAGI1 (9223)
Length:
6261
CDS:
611..4384

Additional Resources:

NCBI RefSeq record:
NM_001365905.1
NBCI Gene record:
MAGI1 (9223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244997 CGAGCTATAGAACTGATTAAG pLKO_005 4253 CDS 100% 13.200 18.480 N MAGI1 n/a
2 TRCN0000244996 TTCGAGGAGGCCGAGAGTATA pLKO_005 4110 CDS 100% 13.200 18.480 N MAGI1 n/a
3 TRCN0000078702 GAGTATAACATGGACCTCTAT pLKO.1 4124 CDS 100% 4.950 6.930 N MAGI1 n/a
4 TRCN0000078699 GCACCTATGAAGGAAACTATT pLKO.1 1149 CDS 100% 13.200 10.560 N MAGI1 n/a
5 TRCN0000299723 GCACCTATGAAGGAAACTATT pLKO_005 1149 CDS 100% 13.200 10.560 N MAGI1 n/a
6 TRCN0000078700 CCGAGGTTATCCATTGCCTTT pLKO.1 2272 CDS 100% 4.050 3.240 N MAGI1 n/a
7 TRCN0000244998 AGAGTCACAAATGGGTTATAA pLKO_005 5883 3UTR 100% 15.000 10.500 N MAGI1 n/a
8 TRCN0000244995 AGTGCCTGGCGTGGACTATAA pLKO_005 1069 CDS 100% 13.200 9.240 N MAGI1 n/a
9 TRCN0000244994 GAACAAGGACCTGCGACATTT pLKO_005 934 CDS 100% 13.200 9.240 N MAGI1 n/a
10 TRCN0000380607 TGGCCTAAGACAAGATCTTTA pLKO_005 4536 3UTR 100% 13.200 9.240 N MAGI1 n/a
11 TRCN0000379658 AGCGAACCAAGTCCTACAATG pLKO_005 1269 CDS 100% 10.800 7.560 N MAGI1 n/a
12 TRCN0000222714 CCACTGAAACTGTGTAACATT pLKO.1 5600 3UTR 100% 5.625 3.938 N MAGI1 n/a
13 TRCN0000222713 CCCTGTCTATGGTATCTACTA pLKO.1 1723 CDS 100% 4.950 3.465 N MAGI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14933 pDONR223 34.2% 81.6% 17.8% None (many diffs) n/a
2 ccsbBroad304_14933 pLX_304 0% 81.6% 17.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000466717 CATAATCGCACCGCATGCTGTAGA pLX_317 5.7% 81.6% 17.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV