Transcript: Human NM_001365951.2

Homo sapiens kinesin family member 1B (KIF1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KIF1B (23095)
Length:
10852
CDS:
389..5839

Additional Resources:

NCBI RefSeq record:
NM_001365951.2
NBCI Gene record:
KIF1B (23095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236538 ACACGCCTTTGAGGGATATAA pLKO_005 637 CDS 100% 15.000 21.000 N KIF1B n/a
2 TRCN0000236539 GTAGGTCGTATTCGGAATAAG pLKO_005 4334 CDS 100% 13.200 18.480 N KIF1B n/a
3 TRCN0000113850 GCCAAACTGGTTCGTGAATTA pLKO.1 1484 CDS 100% 13.200 10.560 N KIF1B n/a
4 TRCN0000113848 GCTGGATTTGATGCGAGAGAT pLKO.1 2932 CDS 100% 4.950 3.960 N KIF1B n/a
5 TRCN0000236536 TGCCAAAGGGACTCGATTAAA pLKO_005 1165 CDS 100% 15.000 10.500 N KIF1B n/a
6 TRCN0000113846 GCGGGAAAGTTAAGAAACATA pLKO.1 8813 3UTR 100% 5.625 3.938 N KIF1B n/a
7 TRCN0000113847 GCCTATTGTATTTGAAGTCTT pLKO.1 3949 CDS 100% 4.950 3.465 N KIF1B n/a
8 TRCN0000113849 GCTCACATTAAAGAAGAGCAT pLKO.1 2108 CDS 100% 2.640 1.848 N KIF1B n/a
9 TRCN0000236537 CAACTAAGAAACCACTATTAT pLKO_005 9225 3UTR 100% 15.000 9.000 N KIF1B n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6088 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11674 pDONR223 100% 31.8% 31.8% None 1_3711del;5301C>A n/a
2 ccsbBroad304_11674 pLX_304 0% 31.8% 31.8% V5 1_3711del;5301C>A n/a
3 TRCN0000469162 GAATGGAGGCACGCGCGGCGGGGA pLX_317 21.6% 31.8% 31.8% V5 1_3711del;5301C>A n/a
Download CSV