Transcript: Human NM_001366051.2

Homo sapiens tubulin tyrosine ligase like 3 (TTLL3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TTLL3 (26140)
Length:
3369
CDS:
175..2493

Additional Resources:

NCBI RefSeq record:
NM_001366051.2
NBCI Gene record:
TTLL3 (26140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248587 TCAAGCAGAAGAAGATCTTTA pLKO_005 218 CDS 100% 13.200 7.920 N Ttll3 n/a
2 TRCN0000048531 GAGCCTTTGAGCTCATCTATA pLKO.1 1703 CDS 100% 13.200 6.600 Y TTLL3 n/a
3 TRCN0000048528 CGCGACAGCTATATCCGCTTT pLKO.1 1237 CDS 100% 4.050 2.025 Y TTLL3 n/a
4 TRCN0000048532 GTAACTGACTGGAACCCACTT pLKO.1 1201 CDS 100% 4.050 2.025 Y TTLL3 n/a
5 TRCN0000048529 TCGCAACATCTGGATCGTGAA pLKO.1 1002 CDS 100% 4.050 2.025 Y TTLL3 n/a
6 TRCN0000048530 CCCAAATGCTTGGTCCACCAT pLKO.1 1422 CDS 100% 2.640 1.320 Y TTLL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11816 pDONR223 100% 56% 55.5% None (many diffs) n/a
2 ccsbBroad304_11816 pLX_304 0% 56% 55.5% V5 (many diffs) n/a
3 TRCN0000468424 CTGGGGCCATCTACCTTAAAATCA pLX_317 20.2% 56% 55.5% V5 (many diffs) n/a
4 ccsbBroadEn_11815 pDONR223 100% 13% 12.9% None 1_816del;1119_2316delinsG n/a
5 ccsbBroad304_11815 pLX_304 0% 13% 12.9% V5 1_816del;1119_2316delinsG n/a
6 TRCN0000472522 TCCTGTGGTGATCTGAGCGCGTCT pLX_317 90.7% 13% 12.9% V5 1_816del;1119_2316delinsG n/a
Download CSV