Transcript: Human NM_001366445.1

Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
2495
CDS:
172..1989

Additional Resources:

NCBI RefSeq record:
NM_001366445.1
NBCI Gene record:
RABGAP1L (9910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048392 CGTAATGAAGTAGAGGCTTTA pLKO.1 496 CDS 100% 10.800 15.120 N RABGAP1L n/a
2 TRCN0000106043 TGTGAAATTAAAGAGGCAGTA pLKO.1 760 CDS 100% 4.050 5.670 N Rabgap1l n/a
3 TRCN0000048390 CCAGCCAAACAAATAAGCCAT pLKO.1 338 CDS 100% 2.640 3.696 N RABGAP1L n/a
4 TRCN0000296306 TCCAATCTATAAGGTGTTATT pLKO_005 642 CDS 100% 13.200 10.560 N RABGAP1L n/a
5 TRCN0000048389 GCCTAAGGATAGAGATAAATT pLKO.1 942 CDS 100% 15.000 10.500 N RABGAP1L n/a
6 TRCN0000305118 TGCCTAAGGATAGAGATAAAT pLKO_005 941 CDS 100% 15.000 10.500 N Rabgap1l n/a
7 TRCN0000048391 GCACCAGTATTTCTGGCACTT pLKO.1 1177 CDS 100% 4.050 2.835 N RABGAP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11431 pDONR223 100% 99.8% 100% None 123A>G;1191T>C n/a
2 ccsbBroad304_11431 pLX_304 0% 99.8% 100% V5 123A>G;1191T>C n/a
3 TRCN0000478216 ACTTTGCACACAACGTACGGCAGA pLX_317 17.3% 99.8% 100% V5 123A>G;1191T>C n/a
Download CSV