Transcript: Human NM_001366449.1

Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
1808
CDS:
97..855

Additional Resources:

NCBI RefSeq record:
NM_001366449.1
NBCI Gene record:
RABGAP1L (9910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048391 GCACCAGTATTTCTGGCACTT pLKO.1 154 CDS 100% 4.050 2.835 N RABGAP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11431 pDONR223 100% 38.8% 37.2% None (many diffs) n/a
2 ccsbBroad304_11431 pLX_304 0% 38.8% 37.2% V5 (many diffs) n/a
3 TRCN0000478216 ACTTTGCACACAACGTACGGCAGA pLX_317 17.3% 38.8% 37.2% V5 (many diffs) n/a
Download CSV