Transcript: Human NM_001366486.2

Homo sapiens aarF domain containing kinase 1 (ADCK1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ADCK1 (57143)
Length:
3070
CDS:
74..1447

Additional Resources:

NCBI RefSeq record:
NM_001366486.2
NBCI Gene record:
ADCK1 (57143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147030 GCTTCGATGACACCCCTCTG pXPR_003 GGG 459 33% 5 0.9285 ADCK1 ADCK1 76085
2 BRDN0001149367 GGTGCGGAAGCACCCCGGCA pXPR_003 CGG 961 70% 8 -0.3947 ADCK1 ADCK1 76087
3 BRDN0001146894 GAGTGTCCCTTATGGCTCAG pXPR_003 AGG 190 14% 3 -0.4793 ADCK1 ADCK1 76086
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199955 GACCGGGTCTTGGCCCTAATA pLKO.1 1400 CDS 100% 4.400 6.160 N ADCK1 n/a
2 TRCN0000197082 GCTGTCATCAGTTACGACTAC pLKO.1 212 CDS 100% 4.050 5.670 N ADCK1 n/a
3 TRCN0000021503 GAAGAAGAATACCTGTTCATT pLKO.1 1282 CDS 100% 5.625 3.938 N ADCK1 n/a
4 TRCN0000197048 GAAGACTCAGCAGCCTACATT pLKO.1 1670 3UTR 100% 5.625 3.938 N ADCK1 n/a
5 TRCN0000196277 GCACATGGTCTCTGAATTTGA pLKO.1 1821 3UTR 100% 5.625 3.938 N ADCK1 n/a
6 TRCN0000342867 GCACATGGTCTCTGAATTTGA pLKO_005 1821 3UTR 100% 5.625 3.938 N ADCK1 n/a
7 TRCN0000021502 CTTCAACTTATGGCAGATCAA pLKO.1 1336 CDS 100% 4.950 3.465 N ADCK1 n/a
8 TRCN0000021499 CCATTCCTGGTATGTGCCATT pLKO.1 1692 3UTR 100% 4.050 2.835 N ADCK1 n/a
9 TRCN0000021500 CCATGATTTGTTCCAGAGCTT pLKO.1 499 CDS 100% 2.640 1.848 N ADCK1 n/a
10 TRCN0000199293 CCAGAGGAAGTCACACCTCAG pLKO.1 1878 3UTR 100% 0.750 0.525 N ADCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03795 pDONR223 100% 87.3% 87.3% None 1006_1007ins198 n/a
2 ccsbBroad304_03795 pLX_304 0% 87.3% 87.3% V5 1006_1007ins198 n/a
3 TRCN0000472002 CCAATTCCCTATTCTTCGGTAGGT pLX_317 28% 87.3% 87.3% V5 1006_1007ins198 n/a
4 ccsbBroadEn_15119 pDONR223 0% 87.3% 87.3% None 1006_1007ins198 n/a
5 ccsbBroad304_15119 pLX_304 0% 87.3% 87.3% V5 1006_1007ins198 n/a
6 TRCN0000467145 AATAATGTTTAACCGTTACCCGGA pLX_317 21.3% 87.3% 87.3% V5 1006_1007ins198 n/a
7 TRCN0000487893 GTTCTAAGCATGATTGCCGCATTA pLX_317 20.1% 87.3% 87.3% V5 (not translated due to prior stop codon) 1006_1007ins198 n/a
Download CSV