Transcript: Human NM_001366560.1

Homo sapiens ATF7-NPFF readthrough (ATF7-NPFF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-28
Taxon:
Homo sapiens (human)
Gene:
ATF7-NPFF (114108587)
Length:
1678
CDS:
126..1508

Additional Resources:

NCBI RefSeq record:
NM_001366560.1
NBCI Gene record:
ATF7-NPFF (114108587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274293 TATCCCTGGCCCACCAGTTAA pLKO_005 824 CDS 100% 13.200 6.600 Y ATF7 n/a
2 TRCN0000274291 ACCAAGTCTCCTCAATCAATG pLKO_005 922 CDS 100% 10.800 5.400 Y ATF7 n/a
3 TRCN0000244029 GGGATCCTGGAGGAATGAATG pLKO_005 1491 CDS 100% 10.800 5.400 Y NPFF n/a
4 TRCN0000086247 CAGTCATCATTGCAGATCAAA pLKO.1 256 CDS 100% 5.625 2.813 Y Atf7 n/a
5 TRCN0000017114 CCGAACTGACTCAGTCATCAT pLKO.1 245 CDS 100% 4.950 2.475 Y ATF7 n/a
6 TRCN0000274351 CCGAACTGACTCAGTCATCAT pLKO_005 245 CDS 100% 4.950 2.475 Y ATF7 n/a
7 TRCN0000017116 CGAAGAACTCACTTCTCAGAA pLKO.1 1217 CDS 100% 4.950 2.475 Y ATF7 n/a
8 TRCN0000274294 CGAAGAACTCACTTCTCAGAA pLKO_005 1217 CDS 100% 4.950 2.475 Y ATF7 n/a
9 TRCN0000244026 GAGCCAAGCCTTCCTGTTTCA pLKO_005 1452 CDS 100% 4.950 2.475 Y NPFF n/a
10 TRCN0000244028 CTCTGGGTCACTGTTGCACTA pLKO_005 1401 CDS 100% 4.050 2.025 Y NPFF n/a
11 TRCN0000017117 GAAGTCACATTACTACGCAAT pLKO.1 1254 CDS 100% 4.050 2.025 Y ATF7 n/a
12 TRCN0000017115 GCAGTTCATAAACACAAGCAT pLKO.1 198 CDS 100% 3.000 1.500 Y ATF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366560.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15736 pDONR223 0% 23.4% 18.3% None (many diffs) n/a
2 ccsbBroad304_15736 pLX_304 0% 23.4% 18.3% V5 (many diffs) n/a
3 TRCN0000492204 CCGAACACCCTCTAACTCGGCCTC pLX_317 100% 23.4% 18.3% V5 (many diffs) n/a
Download CSV