Transcript: Human NM_001367407.1

Homo sapiens WASH complex subunit 2C (WASHC2C), transcript variant 26, mRNA.

Source:
NCBI, updated 2019-02-03
Taxon:
Homo sapiens (human)
Gene:
WASHC2C (253725)
Length:
4682
CDS:
735..4118

Additional Resources:

NCBI RefSeq record:
NM_001367407.1
NBCI Gene record:
WASHC2C (253725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365548 TTACCCAATGTACTTAGTATT pLKO_005 4240 3UTR 100% 13.200 9.240 N WASHC2C n/a
2 TRCN0000134043 CTCATGGTCTTAACTGGATTA pLKO.1 4185 3UTR 100% 10.800 6.480 N WASHC2C n/a
3 TRCN0000263952 AGTGGAAGCCAAGTCTATATT pLKO_005 3944 CDS 100% 15.000 7.500 Y WASHC2A n/a
4 TRCN0000370689 GAGTGCCAAGGAGTCATTAAA pLKO_005 2396 CDS 100% 15.000 7.500 Y WASHC2C n/a
5 TRCN0000365616 GGAAACACCTCAGGCAAATTT pLKO_005 2954 CDS 100% 15.000 7.500 Y WASHC2C n/a
6 TRCN0000370753 ACGATGAAGAGGATAACTTAT pLKO_005 1156 CDS 100% 13.200 6.600 Y WASHC2C n/a
7 TRCN0000365545 GAAACAAGTGGACGGACTAAT pLKO_005 194 5UTR 100% 13.200 6.600 Y WASHC2C n/a
8 TRCN0000263953 GAATCCATTCAAGGTAGTAAA pLKO_005 2913 CDS 100% 13.200 6.600 Y WASHC2A n/a
9 TRCN0000370760 GCCGCACCTGAACCAAGATTT pLKO_005 4041 CDS 100% 13.200 6.600 Y WASHC2C n/a
10 TRCN0000281630 GTCCAATCCACTGCCGATATC pLKO_005 1581 CDS 100% 10.800 5.400 Y WASHC2A n/a
11 TRCN0000282877 TGGATGGGAACCCTAACTTAG pLKO_005 4479 3UTR 100% 10.800 5.400 Y WASHC2A n/a
12 TRCN0000160433 CCATTCAAGGTAGTAAAGAAA pLKO.1 2917 CDS 100% 5.625 2.813 Y WASHC2A n/a
13 TRCN0000344250 CCATTCAAGGTAGTAAAGAAA pLKO_005 2917 CDS 100% 5.625 2.813 Y WASHC2A n/a
14 TRCN0000163901 CCTGACCAGAAGTCTTTGTTA pLKO.1 4456 3UTR 100% 5.625 2.813 Y WASHC2A n/a
15 TRCN0000162987 GCTGTGAACTATGGCTTACAA pLKO.1 467 5UTR 100% 5.625 2.813 Y WASHC2A n/a
16 TRCN0000344330 GCTGTGAACTATGGCTTACAA pLKO_005 467 5UTR 100% 5.625 2.813 Y WASHC2A n/a
17 TRCN0000136995 CCTCTGTTAAGGAGGAGTCTT pLKO.1 1321 CDS 100% 4.950 2.475 Y WASHC2C n/a
18 TRCN0000136398 CGAGAGCAGAAAGAAGTAGAT pLKO.1 425 5UTR 100% 4.950 2.475 Y WASHC2C n/a
19 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 625 5UTR 100% 4.950 2.475 Y LOC387873 n/a
20 TRCN0000158756 GCCAAGTCTATATTTGATGAT pLKO.1 3951 CDS 100% 4.950 2.475 Y WASHC2A n/a
21 TRCN0000344252 GCCAAGTCTATATTTGATGAT pLKO_005 3951 CDS 100% 4.950 2.475 Y WASHC2A n/a
22 TRCN0000136217 GCTCTCTAATACCCAGTTCAT pLKO.1 272 5UTR 100% 4.950 2.475 Y WASHC2C n/a
23 TRCN0000137325 GAGGCTGTGAACTATGGCTTA pLKO.1 464 5UTR 100% 4.050 2.025 Y WASHC2C n/a
24 TRCN0000134757 GCTACATTGTTGAGTTAGTGA pLKO.1 4150 3UTR 100% 3.000 1.500 Y WASHC2C n/a
25 TRCN0000162206 CTCTCTAATACCCAGTTCATT pLKO.1 273 5UTR 100% 5.625 2.813 Y WASHC2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10086 pDONR223 100% 83.4% 82.7% None (many diffs) n/a
2 ccsbBroad304_10086 pLX_304 0% 83.4% 82.7% V5 (many diffs) n/a
Download CSV