Transcript: Human NM_001369437.1

Homo sapiens zinc finger protein 286A (ZNF286A), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
ZNF286A (57335)
Length:
5076
CDS:
350..1579

Additional Resources:

NCBI RefSeq record:
NM_001369437.1
NBCI Gene record:
ZNF286A (57335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271313 TTTCGTAATACCGTCAGTTAA pLKO_005 3952 3UTR 100% 13.200 18.480 N ZNF286A n/a
2 TRCN0000015156 CATTCATTCATCAGCTCTCAT pLKO.1 1438 CDS 100% 4.950 2.970 N ZNF286A n/a
3 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1142 CDS 100% 15.000 7.500 Y Gm10771 n/a
4 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1142 CDS 100% 15.000 7.500 Y ZNF286B n/a
5 TRCN0000350860 GGTTCTTTATGTCCGTTAATT pLKO_005 1735 3UTR 100% 15.000 7.500 Y ZNF286B n/a
6 TRCN0000337317 ACGTTGGAGAGAGACCTTATG pLKO_005 972 CDS 100% 10.800 5.400 Y ZNF286B n/a
7 TRCN0000015155 GCCACAGAGCTAATTTAACTA pLKO.1 855 CDS 100% 5.625 2.813 Y ZNF286A n/a
8 TRCN0000015153 GCAGAGAACTTATAAAGAGAA pLKO.1 712 CDS 100% 4.950 2.475 Y ZNF286A n/a
9 TRCN0000148104 GAGTGTAATGAATGTGGGAAA pLKO.1 1328 CDS 100% 4.050 2.025 Y ZNF658B n/a
10 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2241 3UTR 100% 0.495 0.248 Y C11orf44 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2481 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2347 3UTR 100% 2.640 1.320 Y LINC01098 n/a
13 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 809 CDS 100% 15.000 7.500 Y ZNF443 n/a
14 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 809 CDS 100% 15.000 7.500 Y Zfp97 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2481 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12340 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12340 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480946 CGGGCTCAATCCGAGCGGCAACGA pLX_317 30% 100% 100% V5 n/a
Download CSV