Transcript: Human NM_001369470.1

Homo sapiens nuclear factor I B (NFIB), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
NFIB (4781)
Length:
8165
CDS:
430..1704

Additional Resources:

NCBI RefSeq record:
NM_001369470.1
NBCI Gene record:
NFIB (4781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014678 CCTGGTTATCTCACCAACGAA pLKO.1 2201 3UTR 100% 3.000 4.200 N NFIB n/a
2 TRCN0000012092 CCAACCATACTATCATGACAT pLKO.1 930 CDS 100% 4.950 3.960 N Nfib n/a
3 TRCN0000014681 GCACGAAAGAGATCAAGATAT pLKO.1 1101 CDS 100% 13.200 9.240 N NFIB n/a
4 TRCN0000274066 GCACGAAAGAGATCAAGATAT pLKO_005 1101 CDS 100% 13.200 9.240 N NFIB n/a
5 TRCN0000274124 GCAGCACTTACAATCACTAAT pLKO_005 1952 3UTR 100% 13.200 9.240 N NFIB n/a
6 TRCN0000014680 CCGTGCTGTGTCTTATCCAAT pLKO.1 721 CDS 100% 4.950 3.465 N NFIB n/a
7 TRCN0000274065 CCGTGCTGTGTCTTATCCAAT pLKO_005 721 CDS 100% 4.950 3.465 N NFIB n/a
8 TRCN0000014679 CCGTTGCCATTTCCAACACAA pLKO.1 1285 CDS 100% 4.950 3.465 N NFIB n/a
9 TRCN0000274067 CCGTTGCCATTTCCAACACAA pLKO_005 1285 CDS 100% 4.950 3.465 N NFIB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01091 pDONR223 100% 66.8% 66.4% None (many diffs) n/a
2 ccsbBroad304_01091 pLX_304 0% 66.8% 66.4% V5 (many diffs) n/a
3 TRCN0000468617 CCCGTGCAGTTGAGCGCTAGTGAT pLX_317 31.4% 66.8% 66.4% V5 (many diffs) n/a
Download CSV