Transcript: Human NM_001369522.1

Homo sapiens tripartite motif containing 39 (TRIM39), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-04-10
Taxon:
Homo sapiens (human)
Gene:
TRIM39 (56658)
Length:
3516
CDS:
580..2046

Additional Resources:

NCBI RefSeq record:
NM_001369522.1
NBCI Gene record:
TRIM39 (56658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232462 GGTGGAAGAGGGTGGTATATA pLKO_005 3066 3UTR 100% 15.000 21.000 N TRIM39 n/a
2 TRCN0000232461 ACCCAAGCGGGTAGGCATATT pLKO_005 1851 CDS 100% 13.200 18.480 N TRIM39 n/a
3 TRCN0000033879 GTAGGCATATTCCTAGACTAT pLKO.1 1861 CDS 100% 4.950 6.930 N TRIM39 n/a
4 TRCN0000033880 CCGCTCTCATATCTACACCTT pLKO.1 1917 CDS 100% 2.640 3.696 N TRIM39 n/a
5 TRCN0000369426 TGCTCTCATGGGTCTAGATAT pLKO_005 2517 3UTR 100% 13.200 10.560 N TRIM39 n/a
6 TRCN0000377320 GAAGAATGCTGCACCACTTAC pLKO_005 1998 CDS 100% 10.800 7.560 N TRIM39 n/a
7 TRCN0000232459 CTGCGGCTTTGGAGAACTTAC pLKO_005 629 CDS 100% 10.800 5.400 Y TRIM39 n/a
8 TRCN0000369427 GTATGCTTGATATGTGCAATT pLKO_005 952 CDS 100% 10.800 5.400 Y TRIM39 n/a
9 TRCN0000033881 CGAGATGCTTAAGGATGTCAA pLKO.1 1347 CDS 100% 4.950 2.475 Y TRIM39 n/a
10 TRCN0000033882 CGATGCTACACAGGAGTACAA pLKO.1 1011 CDS 100% 4.950 2.475 Y TRIM39 n/a
11 TRCN0000033883 GTCCTGTCTGTCGAAAGACAT pLKO.1 776 CDS 100% 0.495 0.248 Y TRIM39 n/a
12 TRCN0000232460 TACCGCAGTCTCCGACCTAAT pLKO_005 802 CDS 100% 0.000 0.000 Y TRIM39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03734 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03734 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473810 ACTGCTACCCACAGAAGCTTTACC pLX_317 26.2% 100% 100% V5 n/a
4 ccsbBroadEn_08648 pDONR223 100% 99.8% 100% None 435T>C;939T>C n/a
5 ccsbBroad304_08648 pLX_304 0% 99.8% 100% V5 435T>C;939T>C n/a
6 TRCN0000470388 GGCACTGGGCCTCTGGCTAGAACC pLX_317 31.6% 99.8% 100% V5 435T>C;939T>C n/a
Download CSV