Transcript: Human NM_001369907.1

Homo sapiens synapsin III (SYN3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SYN3 (8224)
Length:
7864
CDS:
250..1992

Additional Resources:

NCBI RefSeq record:
NM_001369907.1
NBCI Gene record:
SYN3 (8224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427438 ATACAGACTGGTCGAAGTATT pLKO_005 551 CDS 100% 13.200 18.480 N SYN3 n/a
2 TRCN0000429751 ACAGATTAAATCAGCGAAATC pLKO_005 1485 CDS 100% 10.800 15.120 N SYN3 n/a
3 TRCN0000155886 CGAGGTAATGGACAGCTCAAT pLKO.1 1341 CDS 100% 4.950 6.930 N SYN3 n/a
4 TRCN0000435523 AGCAATATAGGAGGCAATAAT pLKO_005 2418 3UTR 100% 15.000 10.500 N SYN3 n/a
5 TRCN0000183796 CCTGAGAACATACTTTCTAAA pLKO.1 2095 3UTR 100% 13.200 9.240 N SYN3 n/a
6 TRCN0000179886 CCACTCATACTCAGAGCATTA pLKO.1 2671 3UTR 100% 10.800 7.560 N SYN3 n/a
7 TRCN0000150573 GCCTGAGAACATACTTTCTAA pLKO.1 2094 3UTR 100% 5.625 3.938 N SYN3 n/a
8 TRCN0000156196 CGTGAGAAATGGGACCAAAGT pLKO.1 684 CDS 100% 4.950 3.465 N SYN3 n/a
9 TRCN0000154851 GCCACTCATACTCAGAGCATT pLKO.1 2670 3UTR 100% 4.950 3.465 N SYN3 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4669 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01873 pDONR223 100% 99.8% 99.8% None 460_462delAGC n/a
2 ccsbBroad304_01873 pLX_304 0% 99.8% 99.8% V5 460_462delAGC n/a
3 TRCN0000475371 GCTAAGTTTATGTTCCCTATCCCT pLX_317 19.6% 99.8% 99.8% V5 460_462delAGC n/a
Download CSV