Transcript: Human NM_001369915.1

Homo sapiens SH3 domain containing GRB2 like, endophilin B2 (SH3GLB2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SH3GLB2 (56904)
Length:
1963
CDS:
178..1317

Additional Resources:

NCBI RefSeq record:
NM_001369915.1
NBCI Gene record:
SH3GLB2 (56904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271569 CAAGGTCCCTGTCACCTACTT pLKO_005 1281 CDS 100% 4.950 3.960 N SH3GLB2 n/a
2 TRCN0000162304 CAAGTCTCAGACAACCTACTA pLKO.1 885 CDS 100% 4.950 3.960 N SH3GLB2 n/a
3 TRCN0000271617 ATCAGTAGCACTCACGTGAAC pLKO_005 838 CDS 100% 4.050 3.240 N SH3GLB2 n/a
4 TRCN0000323062 CTGAGCTTGATGCCCACTTTG pLKO_005 275 CDS 100% 10.800 7.560 N SH3GLB2 n/a
5 TRCN0000165368 GAGCTTGATGCCCACTTTGAA pLKO.1 277 CDS 100% 5.625 3.938 N SH3GLB2 n/a
6 TRCN0000284481 AGCAGCATCTTCCGGTGCTAT pLKO_005 1808 3UTR 100% 4.950 3.465 N SH3GLB2 n/a
7 TRCN0000165782 CACCAAGAACTGGACAGAGAA pLKO.1 321 CDS 100% 4.950 3.465 N SH3GLB2 n/a
8 TRCN0000166184 CGTCAAGTCTCAGACAACCTA pLKO.1 882 CDS 100% 3.000 2.100 N SH3GLB2 n/a
9 TRCN0000160383 CCACTTAACTTGTTTGTTGGT pLKO.1 1378 3UTR 100% 2.640 1.848 N SH3GLB2 n/a
10 TRCN0000162583 CTATGGGAAGACACTGATCAA pLKO.1 507 CDS 100% 4.950 2.970 N SH3GLB2 n/a
11 TRCN0000162512 CTGGAATGATGAAGTGGACAA pLKO.1 741 CDS 100% 4.050 2.430 N SH3GLB2 n/a
12 TRCN0000380406 AGTCTCAGACAACCTACTATG pLKO_005 887 CDS 100% 10.800 7.560 N Sh3glb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03753 pDONR223 100% 93.4% 93.2% None 559_560ins63;777_791del;912G>A n/a
2 ccsbBroad304_03753 pLX_304 0% 93.4% 93.2% V5 559_560ins63;777_791del;912G>A n/a
3 TRCN0000469605 TACACTTGGTCCCTTGTGCAGTAC pLX_317 28.5% 93.4% 93.2% V5 559_560ins63;777_791del;912G>A n/a
Download CSV