Transcript: Human NM_001370115.1

Homo sapiens zinc finger MYND-type containing 11 (ZMYND11), transcript variant 28, mRNA.

Source:
NCBI, updated 2019-04-26
Taxon:
Homo sapiens (human)
Gene:
ZMYND11 (10771)
Length:
3920
CDS:
113..1918

Additional Resources:

NCBI RefSeq record:
NM_001370115.1
NBCI Gene record:
ZMYND11 (10771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275479 ACATCAGTGGAGGGTATTATT pLKO_005 2114 3UTR 100% 15.000 21.000 N ZMYND11 n/a
2 TRCN0000285398 CATTGCGAGGATGCTATATAA pLKO_005 826 CDS 100% 15.000 21.000 N ZMYND11 n/a
3 TRCN0000021249 CCACCAGTAATGAGCAGCTAA pLKO.1 1251 CDS 100% 4.950 6.930 N ZMYND11 n/a
4 TRCN0000021253 CCCAGTTTGCAGGAGCATTAA pLKO.1 538 CDS 100% 13.200 9.240 N ZMYND11 n/a
5 TRCN0000275478 CCCAGTTTGCAGGAGCATTAA pLKO_005 538 CDS 100% 13.200 9.240 N ZMYND11 n/a
6 TRCN0000021251 CCTGACAACTGGTTCTGTTAT pLKO.1 914 CDS 100% 13.200 9.240 N ZMYND11 n/a
7 TRCN0000275542 CCTGACAACTGGTTCTGTTAT pLKO_005 914 CDS 100% 13.200 9.240 N ZMYND11 n/a
8 TRCN0000021250 GAAGGGAAATACCGAAGTTAT pLKO.1 731 CDS 100% 13.200 9.240 N ZMYND11 n/a
9 TRCN0000088136 GCAAAGAAAGGACGACGTAAT pLKO.1 1292 CDS 100% 10.800 7.560 N Zmynd11 n/a
10 TRCN0000021252 CGTGTCAACTCAGACAAAGAA pLKO.1 1414 CDS 100% 5.625 3.938 N ZMYND11 n/a
11 TRCN0000275544 CGTGTCAACTCAGACAAAGAA pLKO_005 1414 CDS 100% 5.625 3.938 N ZMYND11 n/a
12 TRCN0000088135 GCTGTGAAAGATGGTCTTATT pLKO.1 287 CDS 100% 13.200 7.920 N Zmynd11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11547 pDONR223 100% 87.2% 87.1% None (many diffs) n/a
2 ccsbBroad304_11547 pLX_304 0% 87.2% 87.1% V5 (many diffs) n/a
3 TRCN0000479986 CACCGGTCCGCCGCCTTCCTTCTT pLX_317 25.1% 87.2% 87.1% V5 (many diffs) n/a
Download CSV