Transcript: Human NM_001371078.1

Homo sapiens CD36 molecule (CD36), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
CD36 (948)
Length:
1974
CDS:
283..1701

Additional Resources:

NCBI RefSeq record:
NM_001371078.1
NBCI Gene record:
CD36 (948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056999 CCGACGTTAATCTGAAAGGAA pLKO.1 1124 CDS 100% 3.000 4.200 N CD36 n/a
2 TRCN0000419016 AGAACCTATTGATGGATTAAA pLKO_005 1344 CDS 100% 15.000 10.500 N CD36 n/a
3 TRCN0000057000 GCCATAATCGACACATATAAA pLKO.1 955 CDS 100% 15.000 10.500 N CD36 n/a
4 TRCN0000437740 ACGGCTGCAGGTCAACCTATT pLKO_005 1437 CDS 100% 10.800 7.560 N CD36 n/a
5 TRCN0000057001 CCTGCTTATCCAGAAGACAAT pLKO.1 375 CDS 100% 4.950 3.465 N CD36 n/a
6 TRCN0000056998 GAAGTTACATATTAGGCCATA pLKO.1 1774 3UTR 100% 4.050 2.835 N CD36 n/a
7 TRCN0000057002 CCATTGGTGATGAGAAGGCAA pLKO.1 1544 CDS 100% 2.640 1.848 N CD36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05961 pDONR223 100% 99.9% 100% None 573G>A n/a
2 ccsbBroad304_05961 pLX_304 0% 99.9% 100% V5 573G>A n/a
3 TRCN0000469598 CAGGCTGCAAACGTATGCACATCT pLX_317 20.6% 99.9% 100% V5 573G>A n/a
4 TRCN0000491898 AACTTATCTTTGGCCATGTCCTCA pLX_317 20.6% 99.9% 100% V5 (not translated due to prior stop codon) 573G>A n/a
Download CSV