Transcript: Human NM_001371366.2

Homo sapiens DUS4L-BCAP29 readthrough (DUS4L-BCAP29), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
DUS4L-BCAP29 (115253422)
Length:
6749
CDS:
350..1795

Additional Resources:

NCBI RefSeq record:
NM_001371366.2
NBCI Gene record:
DUS4L-BCAP29 (115253422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364978 ACTATGACCGGTTCGTAATTT pLKO_005 1883 3UTR 100% 15.000 7.500 Y BCAP29 n/a
2 TRCN0000365011 GACGTCTGGTTACGCTTATTA pLKO_005 1422 CDS 100% 15.000 7.500 Y BCAP29 n/a
3 TRCN0000369968 ATGCCACACATAGGTTGTATT pLKO_005 1909 3UTR 100% 13.200 6.600 Y BCAP29 n/a
4 TRCN0000364977 ATGCCGAAATAGGACTCATTT pLKO_005 1107 CDS 100% 13.200 6.600 Y BCAP29 n/a
5 TRCN0000376604 CAAGGCTTTCCTTACCATTAT pLKO_005 1216 CDS 100% 13.200 6.600 Y BCAP29 n/a
6 TRCN0000369966 GTCAAACAAAGGTGTACTTAA pLKO_005 1462 CDS 100% 13.200 6.600 Y BCAP29 n/a
7 TRCN0000369967 TAGGTCTCAAAGAAATCTTTA pLKO_005 1363 CDS 100% 13.200 6.600 Y BCAP29 n/a
8 TRCN0000060447 CCTTACCATTATCATCCTATT pLKO.1 1225 CDS 100% 10.800 5.400 Y BCAP29 n/a
9 TRCN0000064853 GCTCGTATAGTCTGTCCTTAT pLKO.1 647 CDS 100% 10.800 5.400 Y DUS4L n/a
10 TRCN0000315800 GCTCGTATAGTCTGTCCTTAT pLKO_005 647 CDS 100% 10.800 5.400 Y DUS4L n/a
11 TRCN0000376464 TCTGAACTTCAGGATCGTTTA pLKO_005 1748 CDS 100% 10.800 5.400 Y BCAP29 n/a
12 TRCN0000064856 CCCAATGGTTCGATATTCAAA pLKO.1 445 CDS 100% 5.625 2.813 Y DUS4L n/a
13 TRCN0000315801 CCCAATGGTTCGATATTCAAA pLKO_005 445 CDS 100% 5.625 2.813 Y DUS4L n/a
14 TRCN0000060446 CTCCTGAAAGAACACTCTGAA pLKO.1 1733 CDS 100% 4.950 2.475 Y BCAP29 n/a
15 TRCN0000064857 GCTGCTAACGATGCAAGACTT pLKO.1 614 CDS 100% 4.950 2.475 Y DUS4L n/a
16 TRCN0000060444 GCTGTGAGAGAAGTAAGGAAA pLKO.1 1265 CDS 100% 4.950 2.475 Y BCAP29 n/a
17 TRCN0000064854 CCAATGATTGTTGCCGCTGAT pLKO.1 518 CDS 100% 4.050 2.025 Y DUS4L n/a
18 TRCN0000315881 CCAATGATTGTTGCCGCTGAT pLKO_005 518 CDS 100% 4.050 2.025 Y DUS4L n/a
19 TRCN0000060443 CGCTTATTACTCAACTGGCAA pLKO.1 1434 CDS 100% 2.640 1.320 Y BCAP29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03690 pDONR223 100% 50.1% 50.1% None 1_720del n/a
2 ccsbBroad304_03690 pLX_304 0% 50.1% 50.1% V5 1_720del n/a
3 TRCN0000470082 CCGCTTAGATTACGTTGGCCCAAG pLX_317 63.7% 50.1% 50.1% V5 1_720del n/a
4 ccsbBroadEn_11588 pDONR223 100% 33% 28.1% None (many diffs) n/a
5 ccsbBroad304_11588 pLX_304 0% 33% 28.1% V5 (many diffs) n/a
6 TRCN0000467647 AGGGTCATCAGTACTTGAGAACAC pLX_317 76.7% 33% 28.1% V5 (many diffs) n/a
Download CSV