Transcript: Human NM_001371445.1

Homo sapiens LSM12 homolog (LSM12), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
LSM12 (124801)
Length:
2552
CDS:
85..672

Additional Resources:

NCBI RefSeq record:
NM_001371445.1
NBCI Gene record:
LSM12 (124801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375283 CCTAGCTTCACTCAATGTTAG pLKO_005 318 CDS 100% 10.800 15.120 N Lsm12 n/a
2 TRCN0000136914 CCCTAGCTTCACTCAATGTTA pLKO.1 317 CDS 100% 5.625 7.875 N LSM12 n/a
3 TRCN0000279653 CCCTAGCTTCACTCAATGTTA pLKO_005 317 CDS 100% 5.625 7.875 N LSM12 n/a
4 TRCN0000175803 GTTAGTAAGCTTGCCAGCAAA pLKO.1 334 CDS 100% 4.950 6.930 N Lsm12 n/a
5 TRCN0000137551 CCAGACCATTCACAAGACCAT pLKO.1 435 CDS 100% 2.640 3.696 N LSM12 n/a
6 TRCN0000279608 CCAGACCATTCACAAGACCAT pLKO_005 435 CDS 100% 2.640 3.696 N LSM12 n/a
7 TRCN0000279677 TCATGGAAGAAGTTGTTATTA pLKO_005 491 CDS 100% 15.000 10.500 N LSM12 n/a
8 TRCN0000174818 GACCATTCACAAGACCATTAA pLKO.1 438 CDS 100% 13.200 9.240 N Lsm12 n/a
9 TRCN0000279609 GGGAGGGAAGGGATCCTATAT pLKO_005 748 3UTR 100% 13.200 9.240 N LSM12 n/a
10 TRCN0000174788 GTCATGGAAGAAGTTGTTATT pLKO.1 490 CDS 100% 13.200 9.240 N Lsm12 n/a
11 TRCN0000320121 GTCATGGAAGAAGTTGTTATT pLKO_005 490 CDS 100% 13.200 9.240 N Lsm12 n/a
12 TRCN0000138096 GCTCCTCATTGAGGGATAGTT pLKO.1 1668 3UTR 100% 5.625 3.938 N LSM12 n/a
13 TRCN0000174305 CAAGACCATTAAAGACTGTAA pLKO.1 447 CDS 100% 4.950 3.465 N Lsm12 n/a
14 TRCN0000137118 CCAGTTTGTCTGGTTGACTAA pLKO.1 1917 3UTR 100% 4.950 3.465 N LSM12 n/a
15 TRCN0000193562 GTAGTCATGGAAGAAGTTGTT pLKO.1 487 CDS 100% 4.950 3.465 N Lsm12 n/a
16 TRCN0000133736 CCTTTACTTCTGACTTTCCTT pLKO.1 976 3UTR 100% 3.000 2.100 N LSM12 n/a
17 TRCN0000134167 CAGTATGTTTCAGAAGTGGAA pLKO.1 265 CDS 100% 2.640 1.848 N LSM12 n/a
18 TRCN0000279607 CAGTATGTTTCAGAAGTGGAA pLKO_005 265 CDS 100% 2.640 1.848 N LSM12 n/a
19 TRCN0000138880 GCTCTTCCAGACCATTCACAA pLKO.1 429 CDS 100% 4.950 2.970 N LSM12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09486 pDONR223 100% 99.8% 99.4% None 230C>G n/a
2 ccsbBroad304_09486 pLX_304 0% 99.8% 99.4% V5 230C>G n/a
3 TRCN0000476042 CAAAGTAGTTGGATGCTTCACATG pLX_317 31.9% 99.8% 99.4% V5 230C>G n/a
Download CSV