Transcript: Human NM_001371623.1

Homo sapiens treacle ribosome biogenesis factor 1 (TCOF1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
TCOF1 (6949)
Length:
5026
CDS:
51..4520

Additional Resources:

NCBI RefSeq record:
NM_001371623.1
NBCI Gene record:
TCOF1 (6949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008630 GACGCTTCATATAGATGTGTA pLKO.1 4763 3UTR 100% 4.950 6.930 N TCOF1 n/a
2 TRCN0000342789 GACGCTTCATATAGATGTGTA pLKO_005 4763 3UTR 100% 4.950 6.930 N TCOF1 n/a
3 TRCN0000008631 CCCAAGACTAGCATCTACCAA pLKO.1 356 CDS 100% 3.000 2.400 N TCOF1 n/a
4 TRCN0000342853 CCCAAGACTAGCATCTACCAA pLKO_005 356 CDS 100% 3.000 2.400 N TCOF1 n/a
5 TRCN0000008634 CGTAACCCTTCTGGACATCTA pLKO.1 179 CDS 100% 4.950 3.465 N TCOF1 n/a
6 TRCN0000342852 CGTAACCCTTCTGGACATCTA pLKO_005 179 CDS 100% 4.950 3.465 N TCOF1 n/a
7 TRCN0000008633 GAGTCATCAGACAGCAGTGAT pLKO.1 1701 CDS 100% 4.950 3.465 N TCOF1 n/a
8 TRCN0000342854 GAGTCATCAGACAGCAGTGAT pLKO_005 1701 CDS 100% 4.950 3.465 N TCOF1 n/a
9 TRCN0000008632 GCCGCCAAAGATGACCCAGAT pLKO.1 3759 CDS 100% 1.350 0.945 N TCOF1 n/a
10 TRCN0000342855 GCCGCCAAAGATGACCCAGAT pLKO_005 3759 CDS 100% 1.350 0.945 N TCOF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07041 pDONR223 100% 64% 64% None (many diffs) n/a
2 ccsbBroad304_07041 pLX_304 0% 64% 64% V5 (many diffs) n/a
3 TRCN0000478867 GCTTCCTACTTCATCTACTCCCTA pLX_317 12.6% 64% 64% V5 (many diffs) n/a
Download CSV