Transcript: Human NM_001372166.1

Homo sapiens netrin G1 (NTNG1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
NTNG1 (22854)
Length:
6162
CDS:
628..2079

Additional Resources:

NCBI RefSeq record:
NM_001372166.1
NBCI Gene record:
NTNG1 (22854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001372166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119145 GCTAACAGACAACATAGTTAT pLKO.1 1056 CDS 100% 13.200 18.480 N NTNG1 n/a
2 TRCN0000440386 GAAACTCGATCCTCCGGATAT pLKO_005 816 CDS 100% 10.800 15.120 N NTNG1 n/a
3 TRCN0000428481 TATCACAGCATACGGTCTTAG pLKO_005 1214 CDS 100% 10.800 15.120 N NTNG1 n/a
4 TRCN0000094514 CCAGACAATCTGTTAATGTAT pLKO.1 2849 3UTR 100% 5.625 7.875 N Ntng1 n/a
5 TRCN0000412525 AGTTGGCAGCTGTTGATATTA pLKO_005 2286 3UTR 100% 15.000 10.500 N NTNG1 n/a
6 TRCN0000119144 CCCTGAGCTGATGTTTGATTT pLKO.1 933 CDS 100% 13.200 9.240 N NTNG1 n/a
7 TRCN0000119143 CCTGGAGAAGTCTCTCGATTA pLKO.1 1110 CDS 100% 10.800 7.560 N NTNG1 n/a
8 TRCN0000119146 TGATTTGTGTAAGACTCAGAT pLKO.1 717 CDS 100% 4.950 3.465 N NTNG1 n/a
9 TRCN0000119142 CCACTATACAAGAGTGGCTAT pLKO.1 2726 3UTR 100% 0.405 0.284 N NTNG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001372166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02693 pDONR223 100% 90.6% 90.4% None 1088_1222del n/a
2 ccsbBroad304_02693 pLX_304 0% 90.6% 90.4% V5 1088_1222del n/a
3 TRCN0000492131 AAGAGACCACGCCTCAATATTTAT pLX_317 34.4% 90.6% 90.4% V5 1088_1222del n/a
Download CSV