Transcript: Human NM_001374313.1

Homo sapiens syntaxin binding protein 1 (STXBP1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-19
Taxon:
Homo sapiens (human)
Gene:
STXBP1 (6812)
Length:
3889
CDS:
128..1861

Additional Resources:

NCBI RefSeq record:
NM_001374313.1
NBCI Gene record:
STXBP1 (6812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146326 CCTATAAAGCTGATGATCCAA pLKO.1 759 CDS 100% 3.000 4.200 N STXBP1 n/a
2 TRCN0000147929 GCAGAAACTAAAGCAGCAAAT pLKO.1 3128 3UTR 100% 10.800 7.560 N STXBP1 n/a
3 TRCN0000147480 GCTCAGATGAAGAATCCTATA pLKO.1 611 CDS 100% 10.800 7.560 N STXBP1 n/a
4 TRCN0000147807 GACACTATTGAGGACAAACTT pLKO.1 1589 CDS 100% 5.625 3.938 N STXBP1 n/a
5 TRCN0000146943 CCTCAGTTTCAGATACTTCAT pLKO.1 3020 3UTR 100% 4.950 3.465 N STXBP1 n/a
6 TRCN0000147713 GACTGTATGAAGCATTACCAA pLKO.1 1184 CDS 100% 3.000 2.100 N STXBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01618 pDONR223 100% 96.1% 95.7% None (many diffs) n/a
2 ccsbBroad304_01618 pLX_304 0% 96.1% 95.7% V5 (many diffs) n/a
3 TRCN0000470555 AAACTTCGACCTTTGTGTATGGTA pLX_317 8.3% 96.1% 95.7% V5 (many diffs) n/a
Download CSV