Transcript: Human NM_001619.5

Homo sapiens G protein-coupled receptor kinase 2 (GRK2), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRK2 (156)
Length:
3403
CDS:
228..2297

Additional Resources:

NCBI RefSeq record:
NM_001619.5
NBCI Gene record:
GRK2 (156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144871 TCTGGAACACGTCCCCTCGG pXPR_003 AGG 473 23% 6 0.3625 GRK2 GRK2 75681
2 BRDN0001147663 CTCCTCATAGAATTCCACCA pXPR_003 AGG 247 12% 3 0.3377 GRK2 GRK2 75683
3 BRDN0001147919 CCAGGTCCGAGATCCGCACG pXPR_003 TGG 992 48% 12 0.2077 GRK2 GRK2 75684
4 BRDN0001145957 CATCGCATCATTGGGCGCGG pXPR_003 GGG 596 29% 8 -0.3847 GRK2 GRK2 75682
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001619.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000558 AGCGATAAGTTCACACGGTTT pLKO.1 729 CDS 100% 4.050 5.670 N GRK2 n/a
2 TRCN0000000561 GAGCGATAAGTTCACACGGTT pLKO.1 728 CDS 100% 2.640 3.696 N GRK2 n/a
3 TRCN0000199408 CGGCGGTACTTCTACCTGTTC pLKO.1 1959 CDS 100% 1.350 1.080 N GRK2 n/a
4 TRCN0000000560 CTTCGATGAGGAGGACACAAA pLKO.1 1688 CDS 100% 4.950 3.465 N GRK2 n/a
5 TRCN0000197133 GCATCATGCATGGCTACATGT pLKO.1 1903 CDS 100% 4.950 3.465 N GRK2 n/a
6 TRCN0000000559 GATCAAGAAGTACGAGAAGCT pLKO.1 491 CDS 100% 2.640 1.848 N GRK2 n/a
7 TRCN0000000557 ATTATTGTGATTTCCCGTGGC pLKO.1 2389 3UTR 100% 1.200 0.840 N GRK2 n/a
8 TRCN0000199797 GCGCCCTCTGTCCTGACTTCA pLKO.1 2484 3UTR 100% 0.000 0.000 N GRK2 n/a
9 TRCN0000199115 CCTCGGCTCCTGCTGCACCAA pLKO.1 2448 3UTR 100% 0.000 0.000 N GRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001619.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05787 pDONR223 100% 99.9% 100% None 96C>A n/a
2 ccsbBroad304_05787 pLX_304 0% 99.9% 100% V5 96C>A n/a
3 TRCN0000477370 AAAGATGATACGAAATCGAGCCCG pLX_317 18.7% 99.9% 100% V5 96C>A n/a
4 ccsbBroadEn_14532 pDONR223 0% 99.9% 100% None 96C>A n/a
5 ccsbBroad304_14532 pLX_304 0% 99.9% 100% V5 96C>A n/a
6 TRCN0000471244 TACTCCGCCCAATGAAGTCGAAGT pLX_317 19.9% 99.9% 100% V5 96C>A n/a
7 TRCN0000489243 GCAGTAGAATCCCAGTCAGCGGCA pLX_317 17.3% 99.9% 100% V5 (not translated due to prior stop codon) 96C>A n/a
8 TRCN0000489585 CGTAACTCAGACGTCTCGAGATGA pLX_317 17.2% 99.9% 99.8% V5 96C>A;2067_2068insG n/a
Download CSV