Transcript: Human NM_001704.3

Homo sapiens adhesion G protein-coupled receptor B3 (ADGRB3), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
ADGRB3 (577)
Length:
6090
CDS:
907..5475

Additional Resources:

NCBI RefSeq record:
NM_001704.3
NBCI Gene record:
ADGRB3 (577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356716 TCGAGTATTTCCAACTAATTT pLKO_005 1299 CDS 100% 15.000 21.000 N ADGRB3 n/a
2 TRCN0000378134 ATAGCGGTTTGACGCTCAAAT pLKO_005 4112 CDS 100% 13.200 18.480 N ADGRB3 n/a
3 TRCN0000356780 CCGATGCATCCCATACGAAAT pLKO_005 3437 CDS 100% 10.800 15.120 N ADGRB3 n/a
4 TRCN0000439653 CCGATGCATCCCATACGAAAT pLKO_005 3437 CDS 100% 10.800 15.120 N Adgrb3 n/a
5 TRCN0000008122 CCGCTTCATATGGTTTAGTTT pLKO.1 5755 3UTR 100% 0.000 0.000 N ADGRB3 n/a
6 TRCN0000008124 CCAACTAATTTCCCAGGATTA pLKO.1 1309 CDS 100% 10.800 7.560 N ADGRB3 n/a
7 TRCN0000008123 CCCGCATTACACCACAATCAA pLKO.1 5343 CDS 100% 5.625 3.938 N ADGRB3 n/a
8 TRCN0000008125 GCAGCATTATGGAGGTACATA pLKO.1 3604 CDS 100% 5.625 3.938 N ADGRB3 n/a
9 TRCN0000008126 CCCATGAGTATGAATGAGCTT pLKO.1 4681 CDS 100% 2.640 1.848 N ADGRB3 n/a
10 TRCN0000356773 TTGGACAGATTTCGGGATATA pLKO_005 5248 CDS 100% 13.200 7.920 N ADGRB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489777 TGACATACCTCCTTCTTAAACTTC pLX_317 8% 99.9% 99.9% V5 (not translated due to prior stop codon) 1508A>G;4008G>A n/a
2 TRCN0000489506 GAAACAGACTACTTCGTCAAGTGC pLX_317 8.8% 99.9% 99.8% V5 1508A>G;4008G>A;4566_4567insG n/a
Download CSV