Transcript: Human NM_001771.4

Homo sapiens CD22 molecule (CD22), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CD22 (933)
Length:
3274
CDS:
67..2610

Additional Resources:

NCBI RefSeq record:
NM_001771.4
NBCI Gene record:
CD22 (933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430360 TGCGATGACACGGTCACTTAT pLKO_005 2434 CDS 100% 13.200 18.480 N CD22 n/a
2 TRCN0000057623 GCAGAATACATTCACGCTAAA pLKO.1 930 CDS 100% 10.800 15.120 N CD22 n/a
3 TRCN0000057627 CCTCGAAGTTTGATGGGACAA pLKO.1 269 CDS 100% 4.050 5.670 N CD22 n/a
4 TRCN0000057625 CCAATCCTCTTCCAACAAATT pLKO.1 1136 CDS 100% 13.200 9.240 N CD22 n/a
5 TRCN0000433392 GGGATCTGCTCGTCATCATTT pLKO_005 2955 3UTR 100% 13.200 9.240 N CD22 n/a
6 TRCN0000057624 CCTGGGATGCTACAATCCAAT pLKO.1 2310 CDS 100% 4.950 3.465 N CD22 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2732 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001771.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10716 pDONR223 100% 79.6% 79.3% None (many diffs) n/a
2 ccsbBroad304_10716 pLX_304 0% 79.6% 79.3% V5 (many diffs) n/a
3 TRCN0000491466 TTAGGCATCGGGTTCTGATAACTA pLX_317 12.6% 79.6% 79.3% V5 (many diffs) n/a
Download CSV