Transcript: Human NM_001784.5

Homo sapiens adhesion G protein-coupled receptor E5 (ADGRE5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ADGRE5 (976)
Length:
3213
CDS:
381..2609

Additional Resources:

NCBI RefSeq record:
NM_001784.5
NBCI Gene record:
ADGRE5 (976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356764 GCCGAACTGGAGGAGATATAT pLKO_005 1371 CDS 100% 15.000 21.000 N ADGRE5 n/a
2 TRCN0000369168 GATACTGCTGGTTGGACTTTG pLKO_005 2146 CDS 100% 10.800 8.640 N ADGRE5 n/a
3 TRCN0000356822 CCATCCAGAATGTCATCAAAT pLKO_005 991 CDS 100% 13.200 9.240 N ADGRE5 n/a
4 TRCN0000367682 CGATCCTTATGGCTCATTATG pLKO_005 1702 CDS 100% 13.200 9.240 N ADGRE5 n/a
5 TRCN0000008235 GCGATCCTTATGGCTCATTAT pLKO.1 1701 CDS 100% 13.200 9.240 N ADGRE5 n/a
6 TRCN0000008236 GCTCTCAAACCTTGAAGATAT pLKO.1 1091 CDS 100% 13.200 9.240 N ADGRE5 n/a
7 TRCN0000369243 ATCCAGAACATGACGACATTG pLKO_005 1311 CDS 100% 10.800 7.560 N ADGRE5 n/a
8 TRCN0000008237 GCTGACCTATGTGTTTACCAT pLKO.1 2399 CDS 100% 3.000 2.100 N ADGRE5 n/a
9 TRCN0000008234 CCCTCTTAAGCTAAGACTGAT pLKO.1 3008 3UTR 100% 4.950 2.970 N ADGRE5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00269 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00269 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477982 CGGTAATATTTAACCAAGACTTTA pLX_317 17.1% 100% 100% V5 n/a
4 TRCN0000489436 CACCCCAATTTTGCATTAAACCCT pLX_317 18.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489814 GCGCCGAGATCCTTTGTAATTGGC pLX_317 18.2% 99.9% 100% V5 2225_2226delTA n/a
Download CSV