Transcript: Human NM_001795.5

Homo sapiens cadherin 5 (CDH5), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CDH5 (1003)
Length:
4057
CDS:
88..2442

Additional Resources:

NCBI RefSeq record:
NM_001795.5
NBCI Gene record:
CDH5 (1003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001795.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054089 CCTCACGGATAATCACGATAA pLKO.1 1662 CDS 100% 10.800 15.120 N CDH5 n/a
2 TRCN0000054090 CGTGGATTACGACTTCCTTAA pLKO.1 2349 CDS 100% 10.800 15.120 N CDH5 n/a
3 TRCN0000423787 ACCCAGACCAAGTACACATTT pLKO_005 862 CDS 100% 13.200 10.560 N CDH5 n/a
4 TRCN0000054091 CCGCAATAGACAAGGACATAA pLKO.1 1589 CDS 100% 13.200 10.560 N CDH5 n/a
5 TRCN0000425046 ACGAAACGTGAAGTTCAAATT pLKO_005 1614 CDS 100% 13.200 9.240 N CDH5 n/a
6 TRCN0000054088 CGCCTCTGTCATGTACCAAAT pLKO.1 645 CDS 100% 10.800 7.560 N CDH5 n/a
7 TRCN0000431665 TCACGCATCGGTTGTTCAATG pLKO_005 539 CDS 100% 10.800 7.560 N CDH5 n/a
8 TRCN0000054092 GAGTCGCAAGAATGCCAAGTA pLKO.1 312 CDS 100% 4.950 3.465 N CDH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001795.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10723 pDONR223 100% 85.2% 85% None 1137_1481del;1550T>C;1805T>C n/a
2 ccsbBroad304_10723 pLX_304 0% 85.2% 85% V5 1137_1481del;1550T>C;1805T>C n/a
3 TRCN0000477792 CAGTAGATAGTGAGCTCATATAAC pLX_317 18% 85.2% 85% V5 1137_1481del;1550T>C;1805T>C n/a
Download CSV