Transcript: Human NM_001796.5

Homo sapiens cadherin 8 (CDH8), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CDH8 (1006)
Length:
9316
CDS:
559..2958

Additional Resources:

NCBI RefSeq record:
NM_001796.5
NBCI Gene record:
CDH8 (1006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001796.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413231 ATGGTCAACAATCCGAATTTC pLKO_005 2173 CDS 100% 13.200 18.480 N CDH8 n/a
2 TRCN0000054225 GCTGCTCTAAACTCCGTGATT pLKO.1 1768 CDS 100% 4.950 6.930 N CDH8 n/a
3 TRCN0000094387 CGTAAGGATATTAAACCAGAT pLKO.1 2647 CDS 100% 4.050 5.670 N Cdh8 n/a
4 TRCN0000433509 TATCACTTCCAGTCCTATAAG pLKO_005 1815 CDS 100% 13.200 10.560 N CDH8 n/a
5 TRCN0000054224 CCGATGAATCAGTCTCAAGTT pLKO.1 649 CDS 100% 4.950 3.960 N CDH8 n/a
6 TRCN0000054223 GCCAAGTCATTCAAACTGTTA pLKO.1 2090 CDS 100% 4.950 3.960 N CDH8 n/a
7 TRCN0000054227 GCTGGGACCATATTTCAAATA pLKO.1 871 CDS 100% 13.200 9.240 N CDH8 n/a
8 TRCN0000094388 GCATCCGAATATGAGGCATTT pLKO.1 2047 CDS 100% 10.800 7.560 N Cdh8 n/a
9 TRCN0000054226 CGCCAGAAGCAAGAAGTCTAT pLKO.1 2254 CDS 100% 4.950 3.465 N CDH8 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5875 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001796.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05974 pDONR223 100% 99.9% 100% None 2211G>A n/a
2 ccsbBroad304_05974 pLX_304 0% 99.9% 100% V5 2211G>A n/a
3 TRCN0000479005 CGACCGTGTACTGCATGTCGAGAT pLX_317 17.4% 99.9% 100% V5 2211G>A n/a
Download CSV