Transcript: Human NM_001812.4

Homo sapiens centromere protein C (CENPC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CENPC (1060)
Length:
6823
CDS:
149..2980

Additional Resources:

NCBI RefSeq record:
NM_001812.4
NBCI Gene record:
CENPC (1060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001812.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245069 CATCAGGAGGATTCGTGATTA pLKO_005 2433 CDS 100% 13.200 18.480 N CENPC n/a
2 TRCN0000150037 CCAGACACAATATCGTCTAAA pLKO.1 2468 CDS 100% 13.200 18.480 N CENPC n/a
3 TRCN0000148503 CCCGATGATACGAAGTTGATA pLKO.1 1025 CDS 100% 5.625 7.875 N CENPC n/a
4 TRCN0000148798 CGTGACATTAACACAGAGCAA pLKO.1 218 CDS 100% 2.640 3.696 N CENPC n/a
5 TRCN0000245067 CATATTACCCAAGACGAATTT pLKO_005 1490 CDS 100% 13.200 10.560 N CENPC n/a
6 TRCN0000146466 CGTTCTATGTTCCTTCAGGTA pLKO.1 2892 CDS 100% 2.640 2.112 N CENPC n/a
7 TRCN0000245070 CAGTTTGTATAGTTGGAATAT pLKO_005 3031 3UTR 100% 13.200 9.240 N CENPC n/a
8 TRCN0000245068 TGGACCTTCCAGGCTCAATAA pLKO_005 2200 CDS 100% 13.200 9.240 N CENPC n/a
9 TRCN0000149570 GCATGGTGAGTTGAAGGTATA pLKO.1 2704 CDS 100% 10.800 7.560 N CENPC n/a
10 TRCN0000245066 TTCGTGTCCTCCCGATGATAC pLKO_005 1015 CDS 100% 10.800 7.560 N CENPC n/a
11 TRCN0000146263 CCCAAGACGAATTTCAAAGAA pLKO.1 1497 CDS 100% 5.625 3.938 N CENPC n/a
12 TRCN0000146581 CGAAGTTGATAGAGGATGAAT pLKO.1 1035 CDS 100% 5.625 3.938 N CENPC n/a
13 TRCN0000149366 GACCAAGAGAACACGTTTGAA pLKO.1 2365 CDS 100% 5.625 3.938 N CENPC n/a
14 TRCN0000148134 GAGTCCAAGAACAAACTTGTA pLKO.1 1655 CDS 100% 4.950 3.465 N CENPC n/a
15 TRCN0000147943 GATACGAAGTTGATAGAGGAT pLKO.1 1031 CDS 100% 2.640 1.848 N CENPC n/a
16 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 5251 3UTR 100% 1.080 0.540 Y GPR83 n/a
17 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 5251 3UTR 100% 1.080 0.540 Y MYORG n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6124 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001812.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10731 pDONR223 100% 57.3% 57% None 1614_1615insTG;1618_1639del;1646_2829delinsC n/a
2 ccsbBroad304_10731 pLX_304 0% 57.3% 57% V5 1614_1615insTG;1618_1639del;1646_2829delinsC n/a
3 TRCN0000470764 GACTGTAATTTTACTCACTGTCGA pLX_317 21.4% 57.3% 57% V5 1614_1615insTG;1618_1639del;1646_2829delinsC n/a
Download CSV