Transcript: Human NM_001824.5

Homo sapiens creatine kinase, M-type (CKM), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CKM (1158)
Length:
1556
CDS:
74..1219

Additional Resources:

NCBI RefSeq record:
NM_001824.5
NBCI Gene record:
CKM (1158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001824.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010089 GCTTCACTGTAGACGATGTCA pLKO.1 222 CDS 100% 3.000 4.200 N CKM n/a
2 TRCN0000010088 CGTCCGAAGTAGAACAGGTGC pLKO.1 1104 CDS 100% 0.720 1.008 N CKM n/a
3 TRCN0000199651 GCCAAGGTACTGACCCTTGAA pLKO.1 164 CDS 100% 0.495 0.396 N CKM n/a
4 TRCN0000195689 CTGGATTCTGGCCAATGAAAT pLKO.1 1398 3UTR 100% 13.200 9.240 N CKM n/a
5 TRCN0000195354 CCTTCTCAGAGTTCCAGTTTC pLKO.1 1346 3UTR 100% 10.800 7.560 N CKM n/a
6 TRCN0000195432 CCAGTCCATTGACGACATGAT pLKO.1 1183 CDS 100% 4.950 3.465 N CKM n/a
7 TRCN0000197275 GAGTTCAAAGGGAAGTACTAC pLKO.1 575 CDS 100% 4.950 3.465 N CKM n/a
8 TRCN0000010090 CTACAAACCCACTGACAAGCA pLKO.1 370 CDS 100% 2.640 1.848 N CKM n/a
9 TRCN0000199607 GACCACTTCCTGTTCGACAAG pLKO.1 641 CDS 100% 4.050 2.430 N CKM n/a
10 TRCN0000010091 TGGCACAATGACAACAAGAGC pLKO.1 725 CDS 100% 2.640 1.584 N CKM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001824.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14585 pDONR223 0% 99.7% 99.7% None 369T>C;673T>C;1119T>C n/a
2 ccsbBroad304_14585 pLX_304 0% 99.7% 99.7% V5 369T>C;673T>C;1119T>C n/a
3 TRCN0000480656 CTTAGACCCGATCCTAGATAGACC pLX_317 34.1% 99.7% 99.7% V5 (not translated due to frame shift) 369T>C;673T>C;1119T>C n/a
4 TRCN0000488867 ACCTGCAACGGTCGGCACTGAATC pLX_317 27.9% 99.7% 99.7% V5 (not translated due to prior stop codon) 369T>C;673T>C;1119T>C n/a
5 ccsbBroadEn_13831 pDONR223 100% 99.6% 98.9% None (many diffs) n/a
6 ccsbBroad304_13831 pLX_304 0% 99.6% 98.9% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000468913 GAGGATCCGTACGAAATCCACCCA pLX_317 31.6% 99.6% 98.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV