Transcript: Human NM_001938.3

Homo sapiens down-regulator of transcription 1 (DR1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
DR1 (1810)
Length:
10124
CDS:
740..1270

Additional Resources:

NCBI RefSeq record:
NM_001938.3
NBCI Gene record:
DR1 (1810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422869 AGTCCTTCGTTTGATCAATAA pLKO_005 1530 3UTR 100% 13.200 18.480 N DR1 n/a
2 TRCN0000421698 GAAGTCTTGCAAGAGTGTAAA pLKO_005 1004 CDS 100% 13.200 18.480 N DR1 n/a
3 TRCN0000218295 TCAAAGAGACTCTTCCTAATG pLKO_005 804 CDS 100% 10.800 15.120 N Dr1 n/a
4 TRCN0000013783 GCCCTATATGAATTAACTGAT pLKO.1 2389 3UTR 100% 4.950 6.930 N DR1 n/a
5 TRCN0000013787 CATGTCATACAAGCACTAGAA pLKO.1 947 CDS 100% 4.950 3.960 N DR1 n/a
6 TRCN0000432969 CCCAGAGCTGCTATCAATAAA pLKO_005 779 CDS 100% 15.000 10.500 N DR1 n/a
7 TRCN0000374047 CTCTTACATCAGTGAAGTAAA pLKO_005 982 CDS 100% 13.200 9.240 N Dr1 n/a
8 TRCN0000433990 GCCTCAGCCAGTGCATCTAAT pLKO_005 1205 CDS 100% 13.200 9.240 N DR1 n/a
9 TRCN0000425637 GTGGACTTGTCATTGGTATTC pLKO_005 1369 3UTR 100% 10.800 7.560 N DR1 n/a
10 TRCN0000013784 GCCAATGAGATTTGTAACAAA pLKO.1 899 CDS 100% 5.625 3.938 N DR1 n/a
11 TRCN0000013785 CCTTATATCTTCTGAAGCCAA pLKO.1 883 CDS 100% 2.640 1.848 N DR1 n/a
12 TRCN0000013786 GAAGAGTTATTGAGACAGCAA pLKO.1 1085 CDS 100% 2.640 1.848 N DR1 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8382 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8383 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5745 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 5503 3UTR 100% 0.495 0.248 Y C11orf44 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5745 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00462 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00462 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470738 GTGATTTATATAACACTGGTAAAC pLX_317 91.6% 100% 100% V5 n/a
Download CSV