Transcript: Human NM_002181.4

Homo sapiens Indian hedgehog signaling molecule (IHH), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
IHH (3549)
Length:
2473
CDS:
455..1690

Additional Resources:

NCBI RefSeq record:
NM_002181.4
NBCI Gene record:
IHH (3549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002181.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436856 ACGTGCATTGCTCCGTCAAGT pLKO_005 1008 CDS 100% 4.950 6.930 N IHH n/a
2 TRCN0000033323 CGGACGCTATGAAGGCAAGAT pLKO.1 646 CDS 100% 4.950 6.930 N IHH n/a
3 TRCN0000033322 CTGCTCTTTACGGCTGACAAT pLKO.1 1280 CDS 100% 4.950 6.930 N IHH n/a
4 TRCN0000033321 CCGCAATAAGTATGGACTGCT pLKO.1 931 CDS 100% 2.640 3.696 N IHH n/a
5 TRCN0000416092 CTCAGTTGATGCTGCTAAATT pLKO_005 2060 3UTR 100% 15.000 10.500 N IHH n/a
6 TRCN0000033320 CCTTCAGCGATGTGCTCATTT pLKO.1 1170 CDS 100% 13.200 9.240 N IHH n/a
7 TRCN0000412780 ACAATCCAGACATCATCTTCA pLKO_005 708 CDS 100% 4.950 3.465 N IHH n/a
8 TRCN0000033319 CCTGAGACTCTTTCACAGCTT pLKO.1 1543 CDS 100% 2.640 1.848 N IHH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002181.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10918 pDONR223 100% 71.1% 71.2% None 1_354del;600G>A;1128T>C n/a
2 ccsbBroad304_10918 pLX_304 0% 71.1% 71.2% V5 1_354del;600G>A;1128T>C n/a
3 TRCN0000471091 TGGACAAATGACTGTCGTACCGTT pLX_317 51% 71.1% 71.2% V5 1_354del;600G>A;1128T>C n/a
Download CSV