Transcript: Human NM_002232.5

Homo sapiens potassium voltage-gated channel subfamily A member 3 (KCNA3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
KCNA3 (3738)
Length:
2476
CDS:
132..1859

Additional Resources:

NCBI RefSeq record:
NM_002232.5
NBCI Gene record:
KCNA3 (3738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002232.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445607 ACAGTGGGTTACGGCGATATG pLKO_005 1461 CDS 100% 10.800 15.120 N KCNA3 n/a
2 TRCN0000044118 CGAACAATAATCCCAACTCTT pLKO.1 1804 CDS 100% 4.950 6.930 N KCNA3 n/a
3 TRCN0000044122 GCTCCGCAACGAGTACTTCTT pLKO.1 557 CDS 100% 4.950 6.930 N KCNA3 n/a
4 TRCN0000044120 CGGTGTCTTGACCATCGCATT pLKO.1 1532 CDS 100% 4.050 5.670 N KCNA3 n/a
5 TRCN0000044121 GACTCTGAGTAAGTCGGAGTA pLKO.1 1697 CDS 100% 4.050 5.670 N KCNA3 n/a
6 TRCN0000044119 GCGAAACATCATGAACCTGAT pLKO.1 1103 CDS 100% 4.050 5.670 N KCNA3 n/a
7 TRCN0000422211 GCACATCAATTCGTAGTAAAT pLKO_005 2244 3UTR 100% 13.200 9.240 N KCNA3 n/a
8 TRCN0000069188 TCTGAGTAAGTCGGAGTATAT pLKO.1 1700 CDS 100% 13.200 9.240 N Kcna3 n/a
9 TRCN0000069191 CGACGCCATCCTCTACTACTA pLKO.1 599 CDS 100% 4.950 2.475 Y Kcna3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002232.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14683 pDONR223 98.6% 90.8% 90.9% None 1_156del;1035C>A n/a
2 ccsbBroad304_14683 pLX_304 0% 90.8% 90.9% V5 1_156del;1035C>A n/a
3 TRCN0000472900 GAACGCGAACACTTGGCGACCTGG pLX_317 30.8% 90.8% 90.9% V5 1_156del;1035C>A n/a
Download CSV