Transcript: Human NM_002267.4

Homo sapiens karyopherin subunit alpha 3 (KPNA3), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KPNA3 (3839)
Length:
4222
CDS:
177..1742

Additional Resources:

NCBI RefSeq record:
NM_002267.4
NBCI Gene record:
KPNA3 (3839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375209 GGAACGTCACATGGGTCATTG pLKO_005 829 CDS 100% 10.800 15.120 N Kpna3 n/a
2 TRCN0000065320 GCAGAATGTAATACCACCGTT pLKO.1 1403 CDS 100% 2.640 3.696 N KPNA3 n/a
3 TRCN0000065321 GCGATGTGGAAACAATGCGAA pLKO.1 235 CDS 100% 2.640 3.696 N KPNA3 n/a
4 TRCN0000286540 GCGATGTGGAAACAATGCGAA pLKO_005 235 CDS 100% 2.640 3.696 N KPNA3 n/a
5 TRCN0000293950 TTGTCCTCCACAAACATATTT pLKO_005 2184 3UTR 100% 15.000 10.500 N KPNA3 n/a
6 TRCN0000065318 GCTGTAATAGATGCTGGATTA pLKO.1 1263 CDS 100% 10.800 7.560 N KPNA3 n/a
7 TRCN0000286473 GCTGTAATAGATGCTGGATTA pLKO_005 1263 CDS 100% 10.800 7.560 N KPNA3 n/a
8 TRCN0000065322 CCACATCAGAATGTTTGTGAA pLKO.1 681 CDS 100% 4.950 3.465 N KPNA3 n/a
9 TRCN0000286474 CCACATCAGAATGTTTGTGAA pLKO_005 681 CDS 100% 4.950 3.465 N KPNA3 n/a
10 TRCN0000065319 GCTCTGTCATACTTGACAGAT pLKO.1 969 CDS 100% 0.495 0.347 N KPNA3 n/a
11 TRCN0000293908 CACCGATTGATGACTTAATAA pLKO_005 490 CDS 100% 15.000 9.000 N KPNA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06502 pDONR223 100% 99.6% 99.2% None (many diffs) n/a
2 ccsbBroad304_06502 pLX_304 0% 99.6% 99.2% V5 (many diffs) n/a
3 TRCN0000478199 TCGGTTCTCAAACTCTCAATGTTG pLX_317 16.4% 99.6% 99.2% V5 (many diffs) n/a
Download CSV