Transcript: Human NM_002370.4

Homo sapiens mago homolog, exon junction complex subunit (MAGOH), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MAGOH (4116)
Length:
656
CDS:
71..511

Additional Resources:

NCBI RefSeq record:
NM_002370.4
NBCI Gene record:
MAGOH (4116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006615 GAAATCGTCATTGGAGATGAA pLKO.1 335 CDS 100% 4.950 3.465 N MAGOH n/a
2 TRCN0000006613 CGGGAAGTTAAGATATGCCAA pLKO.1 157 CDS 100% 2.640 1.848 N MAGOH n/a
3 TRCN0000435998 ACCAATCTAGACTGAATATTG pLKO_005 502 CDS 100% 13.200 7.920 N MAGOH n/a
4 TRCN0000006614 CCAGAAGGCTTACGAGTATTT pLKO.1 416 CDS 100% 13.200 7.920 N MAGOH n/a
5 TRCN0000011035 CCGGACGGGAAGTTAAGATAT pLKO.1 152 CDS 100% 13.200 7.920 N MAGOH n/a
6 TRCN0000430899 GTCCAGGACCTGAAGTGTTTG pLKO_005 446 CDS 100% 10.800 6.480 N MAGOH n/a
7 TRCN0000435780 GTTCCCTTATTGATGTCAATC pLKO_005 384 CDS 100% 10.800 6.480 N MAGOH n/a
8 TRCN0000413830 ACCAAAGAGGATGATGCATTG pLKO_005 278 CDS 100% 6.000 3.600 N MAGOH n/a
9 TRCN0000431887 CACGAGTTCCTGGAGTTTGAG pLKO_005 125 CDS 100% 4.950 2.970 N MAGOH n/a
10 TRCN0000426058 GCGTGATGGAGGAACTGAAGA pLKO_005 234 CDS 100% 4.950 2.970 N MAGOH n/a
11 TRCN0000436007 ATCAATCCAAGGATCCAGAAG pLKO_005 402 CDS 100% 4.050 2.430 N MAGOH n/a
12 TRCN0000006612 CTGAATATTGGTGTGGACATG pLKO.1 513 3UTR 100% 4.050 2.430 N MAGOH n/a
13 TRCN0000430493 TGGAGATGAACACATTTCTTT pLKO_005 346 CDS 100% 5.625 2.813 Y MAGOH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002370.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00970 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00970 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472892 GCGCCTCGAAAGTTGTCGTGATGT pLX_317 100% 100% 100% V5 n/a
Download CSV