Transcript: Human NM_002428.4

Homo sapiens matrix metallopeptidase 15 (MMP15), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MMP15 (4324)
Length:
4062
CDS:
598..2607

Additional Resources:

NCBI RefSeq record:
NM_002428.4
NBCI Gene record:
MMP15 (4324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002428.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051708 TCTGACCTTTAGCATCCAGAA pLKO.1 1026 CDS 100% 4.050 3.240 N MMP15 n/a
2 TRCN0000294200 TTTCTGGCCCACGCCTATTTC pLKO_005 1249 CDS 100% 13.200 9.240 N MMP15 n/a
3 TRCN0000307291 GGCACCTTACTTGACCATTTG pLKO_005 2771 3UTR 100% 10.800 7.560 N MMP15 n/a
4 TRCN0000051712 CCAGTGGAAGGACGTTGACAA pLKO.1 1440 CDS 100% 4.950 3.465 N MMP15 n/a
5 TRCN0000286916 CCAGTGGAAGGACGTTGACAA pLKO_005 1440 CDS 100% 4.950 3.465 N MMP15 n/a
6 TRCN0000051710 GCCGACATCATGGTACTCTTT pLKO.1 1180 CDS 100% 4.950 3.465 N MMP15 n/a
7 TRCN0000286917 GCCGACATCATGGTACTCTTT pLKO_005 1180 CDS 100% 4.950 3.465 N MMP15 n/a
8 TRCN0000051711 CCTGAGCAATGACGCAGCCTA pLKO.1 2151 CDS 100% 0.880 0.616 N MMP15 n/a
9 TRCN0000286918 CCTGAGCAATGACGCAGCCTA pLKO_005 2151 CDS 100% 0.880 0.616 N MMP15 n/a
10 TRCN0000051709 CGGTGACATCAGTGCTGCCTA pLKO.1 1845 CDS 100% 0.880 0.616 N MMP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002428.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10973 pDONR223 100% 84.2% 84.1% None 1_315del;1825G>A n/a
2 ccsbBroad304_10973 pLX_304 0% 84.2% 84.1% V5 1_315del;1825G>A n/a
3 TRCN0000476456 ACATCCCATCGCACCAAACTGGAG pLX_317 21% 84.2% 84.1% V5 1_315del;1825G>A n/a
Download CSV